ID: 1086619481

View in Genome Browser
Species Human (GRCh38)
Location 11:88868060-88868082
Sequence TTGTCTAAGGTCATGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 2, 1: 0, 2: 6, 3: 33, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086619481 Original CRISPR TTGTCTAAGGTCATGTATCT AGG (reversed) Intronic
901753499 1:11426862-11426884 TTGACCAAGGCCATGCATCTAGG + Intergenic
902114942 1:14113725-14113747 TTTTCCAAGGTCATGGAGCTTGG - Intergenic
902592790 1:17487057-17487079 TGGTCCCAGGTCACGTATCTGGG + Intergenic
902604631 1:17561972-17561994 TTGTCCAAGGTCACATAGCTAGG - Intronic
903327406 1:22577353-22577375 TTGCCCAAGGTCATGCAGCTGGG + Intronic
904935014 1:34123870-34123892 TTGTCCAAGGTCATACAACTAGG + Intronic
905003146 1:34689116-34689138 TTACCCAAGGTCATGCATCTAGG - Intergenic
905543184 1:38776512-38776534 TTGCCTAAGGTCATACACCTAGG - Intergenic
905908918 1:41640477-41640499 TTGTCCAAGGTCACTTAGCTGGG - Intronic
907755244 1:57304520-57304542 TTGCCTAAGGTCACATATCTGGG - Intronic
908050203 1:60221284-60221306 TTGTCAAAGGTCATTCACCTAGG + Intergenic
908085812 1:60632716-60632738 TTGCTTAAGGTCACGTAGCTAGG - Intergenic
908463803 1:64371663-64371685 TTGCCTAAGGACATGCAGCTAGG + Intergenic
909330879 1:74409197-74409219 TTGCCCAAGGTCATGTAACTAGG + Intronic
909746981 1:79109400-79109422 TTGTCTAGAGTCATGTAAGTTGG + Intergenic
909991345 1:82226220-82226242 TTGTTTAAGATCCTGTATCCAGG - Intergenic
910877323 1:91889256-91889278 TTGTATAAAGGCATGTATATCGG - Intronic
915013488 1:152712071-152712093 TTATCTAAGGTCACACATCTAGG + Intergenic
916710841 1:167406033-167406055 TTATCTAAGCTTAGGTATCTGGG - Intronic
916808750 1:168285963-168285985 TTGCCTAAGGTCTTGTAACTGGG - Intronic
917816617 1:178716808-178716830 TTGTCCAAGGTCATGCTGCTAGG - Intergenic
918016799 1:180642580-180642602 TTGCCCAAGGTCATGTAGCTAGG + Intronic
919587745 1:199459694-199459716 TTATCTAAGATTATGTAACTGGG - Intergenic
922187104 1:223285405-223285427 CTGTCCAAAGTCATGTATTTTGG - Intronic
922474567 1:225898378-225898400 TTGTCCAAGGTCACCTAGCTAGG - Intronic
923257772 1:232235820-232235842 TTGTCTCAGGTCCTGCTTCTAGG + Intergenic
1064836618 10:19539275-19539297 TTGTCCAAGGTCATAGAGCTGGG + Intronic
1065843209 10:29722914-29722936 TTGGCCAGAGTCATGTATCTAGG - Intronic
1067485887 10:46649504-46649526 TTGTCCAATGTCATACATCTAGG - Intergenic
1067608869 10:47692149-47692171 TTGTCCAATGTCATACATCTAGG + Intergenic
1068662314 10:59635346-59635368 TTGTCTTAGGGCATGGAGCTGGG - Intergenic
1068684958 10:59860711-59860733 TTCTATTAGGTCATGTATATGGG - Intronic
1068856926 10:61807312-61807334 TTGTTTAAGGCAATGTATATGGG + Intergenic
1069170290 10:65219480-65219502 TGGTCCTAGGTCATTTATCTAGG - Intergenic
1069619313 10:69826729-69826751 TTGTCTAAGTCCTTGTATTTGGG - Intronic
1071624452 10:87153791-87153813 TTGTCCAATGTCATACATCTAGG + Intronic
1072243281 10:93517880-93517902 TTGCCTAAGGCCATATATCCTGG - Intronic
1073479659 10:103778502-103778524 TTGGCCAAGGTCATGTAGCTAGG - Intronic
1074547841 10:114415613-114415635 TTTTCTAAAGCCATGGATCTGGG + Intergenic
1078858918 11:15229485-15229507 TTGTCCAAGGTCACATAGCTGGG - Intronic
1078944696 11:16051318-16051340 TTGTCTAAGGCCATATAACGGGG + Intronic
1079354737 11:19720846-19720868 TTGTTGAAGGTCATGTAGCAAGG - Intronic
1079501557 11:21106258-21106280 TTGTCTAAGGTCACATAGCTAGG - Intronic
1080119998 11:28666255-28666277 TTGTCTAGGGTCTCATATCTTGG + Intergenic
1081393031 11:42552192-42552214 TTGTCTCAGGTTCTGTTTCTAGG + Intergenic
1082230572 11:49760910-49760932 TTGTCTAAGGTCATGTATCTAGG + Intergenic
1082809433 11:57470161-57470183 TTGTCCAAAGTCATATATATAGG - Intronic
1083615553 11:64024428-64024450 TTGCCCAAGGTCATGCAGCTGGG + Intronic
1085455975 11:76665608-76665630 TTGTCCAAGGTCATTCAGCTGGG - Intronic
1085528661 11:77178920-77178942 TTGCCCAAGGTCATATAGCTAGG + Intronic
1086173737 11:83865273-83865295 TTCCCCAAGGTCATGTGTCTGGG - Intronic
1086619481 11:88868060-88868082 TTGTCTAAGGTCATGTATCTAGG - Intronic
1086929816 11:92680818-92680840 TTGCCCAAGGTCATTTAACTGGG + Intronic
1087541118 11:99521323-99521345 TTTTCTGAGATCAAGTATCTAGG + Intronic
1090701890 11:129303816-129303838 TTGCCTAAGGACATGTGGCTAGG - Intergenic
1092520048 12:9261839-9261861 TTATCCAAGGTCATGTATCTAGG + Intergenic
1093707422 12:22289605-22289627 TTATCTCAGGTCACGTAACTAGG + Intronic
1093815746 12:23544298-23544320 TTGCCTAAACTCAAGTATCTTGG - Intronic
1097315647 12:58168280-58168302 TTGTCTAAAGTTATGTGACTTGG + Intergenic
1097741759 12:63251546-63251568 TTGACTAAGGACAAGTAACTTGG - Intergenic
1098453995 12:70651844-70651866 TTGTCCAAAGTCAAGTAGCTTGG - Intronic
1099103777 12:78476472-78476494 TTTTCTTAGGTCATCAATCTAGG + Intergenic
1101776763 12:107802328-107802350 TTGTTTAAGGTCTTGTGTTTTGG - Intergenic
1102835408 12:116053661-116053683 TTGCCTAAGGTCATATAACTTGG + Intronic
1103289504 12:119833221-119833243 TTTCCCAAGGTCATGTAGCTAGG + Intronic
1103397646 12:120620315-120620337 TTGCCTAAGGTCACATAACTAGG + Intergenic
1103577576 12:121889745-121889767 CTATCTAAGGTCATGTAGTTCGG + Intronic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1107114385 13:36731072-36731094 TTGTGTAGGGTCATCTAGCTGGG + Intergenic
1107154306 13:37148245-37148267 TTGTTTAAGGGCCTGTTTCTGGG + Intergenic
1107351844 13:39523067-39523089 TTGTCTAAGGTCATACAATTAGG - Intronic
1108366288 13:49717609-49717631 TTGTCTCATGTCATATAACTAGG - Intronic
1110898169 13:80783629-80783651 ATATCTAAACTCATGTATCTAGG - Intergenic
1113009641 13:105749020-105749042 TTTTCTAAGGTCAGATATCATGG + Intergenic
1113323202 13:109257583-109257605 TTGTCCAAGGTCACCTGTCTGGG - Intergenic
1114185809 14:20401346-20401368 CTGTCTAAAGTCATGTTGCTGGG + Intronic
1114360654 14:21968496-21968518 TTGGCTAAGGTCAATTTTCTAGG + Intergenic
1114851103 14:26383399-26383421 TTGCCTAAGGTCATATATCTGGG - Intergenic
1115497764 14:34023926-34023948 TTGTCTAAAGTCATGTAACTGGG + Intronic
1115741961 14:36398135-36398157 TTGTCCAAGGTCACACATCTAGG - Intergenic
1117501044 14:56351565-56351587 ATGTCTAAGGCCCTGTATCAAGG - Intergenic
1117656237 14:57959658-57959680 TTGTCTAAGGTCACAGGTCTCGG - Intronic
1118093781 14:62513434-62513456 TTGTTTAAGGACATGCATATGGG - Intergenic
1119101414 14:71883458-71883480 TTGTCTAAGGACAGGTAATTTGG - Intergenic
1119427478 14:74545225-74545247 TTGTCCAAGGTCATACATCTAGG - Intronic
1119436758 14:74602547-74602569 TTGTCCAAGGTCATGTAGTCAGG - Intronic
1120616266 14:86708979-86709001 TTGTGCAAGGTCATGCAGCTAGG - Intergenic
1202905430 14_GL000194v1_random:68847-68869 TGGTCTGAGGTCCTGCATCTGGG + Intergenic
1124879588 15:33629000-33629022 TTGTGTAAGGTCATGTCTGAAGG + Intronic
1125342155 15:38685781-38685803 TTGCCCAAGGTCATGTAGCTGGG + Intergenic
1126812735 15:52424348-52424370 TTTTCTAAGGTCACGTAACTAGG - Intronic
1128394728 15:67212484-67212506 TTGTCTAAGGTCATACAGGTAGG - Intronic
1128454421 15:67824612-67824634 TTGTCTGAGGACATGTGGCTGGG + Intronic
1128529631 15:68435504-68435526 ATGTAAAAGGTCATGTAACTAGG + Intergenic
1128785729 15:70395533-70395555 TTGTCTGAGGTCATGTGTCCAGG + Intergenic
1129758262 15:78111736-78111758 TTGTCTAAGGCCACATAACTAGG + Intronic
1131183532 15:90256485-90256507 TTGCCCAAGGTCACATATCTGGG - Intronic
1133311762 16:4852628-4852650 TTCTTTAAGGTCAAGGATCTAGG + Exonic
1133335193 16:5002523-5002545 TTTTCTAAGGACACGTATGTTGG + Intronic
1133643496 16:7740757-7740779 TTGTCCAAGGCCTTGTAACTAGG - Intergenic
1135492279 16:22919862-22919884 TTCCCCAAGGTCATGTAGCTAGG - Intergenic
1137357915 16:47784325-47784347 TTGTCTTAGGTCAGTTCTCTGGG - Intergenic
1137608316 16:49801808-49801830 TTGTCAAAAGTCATGGAGCTAGG + Intronic
1138951846 16:61921646-61921668 TTTTCTAACATCATGTATTTGGG - Intronic
1139014653 16:62675667-62675689 TTGTGTGAGGTCATGCAGCTGGG - Intergenic
1139070711 16:63378753-63378775 TTGTCCAAGCTGATGTAACTTGG - Intergenic
1139214539 16:65114431-65114453 TTATCTAAGCTCATGAGTCTGGG - Intronic
1141157294 16:81606211-81606233 TTGCCCAAGGTCATCTAGCTAGG - Intronic
1146479754 17:33195734-33195756 TTGCCGAAGGTCATGCAGCTAGG + Intronic
1147550729 17:41439619-41439641 TTGCGTAAGATCATGCATCTTGG + Intronic
1149071758 17:52551888-52551910 CTGTCCAAGGTCATTCATCTAGG + Intergenic
1149206738 17:54256549-54256571 TTAACTATGGTCATGTATCTGGG + Intergenic
1150065861 17:62108880-62108902 TTGTCTTGGGTCATATCTCTGGG + Intergenic
1151338763 17:73456371-73456393 TTGTCTAAGGTCACCTAACTAGG + Intronic
1151526795 17:74675452-74675474 TTGTATTAGGGCATGCATCTTGG + Intronic
1152248776 17:79200627-79200649 GTGTCTCAGGTCACGTCTCTGGG + Intronic
1153316753 18:3729830-3729852 TTGTCAGAGTTCATGTATTTTGG + Intronic
1157242196 18:46021126-46021148 TTGTCTAAGTTGATGTAGTTTGG + Intronic
1158816070 18:61098686-61098708 TTTTATAAGGTCTTGTATTTTGG - Intergenic
1159368391 18:67500355-67500377 TTGTCTAATGTGATGTTTGTAGG - Intergenic
1163327278 19:16613140-16613162 TTGTCCAAGGACATATAACTTGG + Intronic
1165187443 19:34034174-34034196 TTTTCTTAAATCATGTATCTGGG - Intergenic
1166538201 19:43589176-43589198 TTGTCTGAGGTCAGGGACCTGGG - Exonic
1166603287 19:44117254-44117276 TTGTCCAAGGTCATGTGACCAGG + Intronic
1168256358 19:55167744-55167766 TGGTCTAAGCTCATGTGTCTGGG - Intergenic
925297426 2:2787019-2787041 TTGTCTAATGTCATGTATGGTGG - Intergenic
927881768 2:26694133-26694155 TTGCCCAAGGTCATATATCACGG - Intronic
928437805 2:31266985-31267007 TTGCCTCAGGTCTGGTATCTGGG - Exonic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929644273 2:43611400-43611422 TTTTCCAAGGTGCTGTATCTGGG - Intergenic
930585053 2:53258609-53258631 TTGCCTAAGGTCAAGGAGCTGGG - Intergenic
931019320 2:58025173-58025195 CTGCCTAAGGTCACATATCTTGG - Intronic
931046751 2:58362587-58362609 TTGTCTAAGGTCATTCAGCTGGG + Intergenic
931227782 2:60348826-60348848 TTTCCCAAGGTCATGTAACTAGG - Intergenic
931593829 2:63917834-63917856 TTGTCTAAGGTTACATAGCTAGG - Intronic
932169622 2:69541891-69541913 TTGCCTAAAGTCATATAACTAGG - Intronic
933015593 2:77121725-77121747 TTGGCTAATGTCATCTACCTAGG - Intronic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
937714496 2:125015881-125015903 TTGCCTAAAATCAAGTATCTGGG - Intergenic
938155134 2:128930232-128930254 TTGTCTAGTGTCAGGTGTCTTGG + Intergenic
939602488 2:144210195-144210217 TTGTCCAAGGTCATACAGCTTGG - Intronic
939933721 2:148262627-148262649 TTGTCCAAGGTCATATACCAAGG + Intronic
941434210 2:165448476-165448498 TTGACTATGGTCATGCAGCTGGG - Intergenic
941784774 2:169485424-169485446 TTTTCCAAGGTCACGTAGCTAGG + Intronic
1168760979 20:349283-349305 TTGTCTAAGGTCACGCCTCCAGG + Exonic
1169712333 20:8579113-8579135 ATGTCTAAGGGCATGGATCCAGG - Intronic
1170786711 20:19473574-19473596 ATTTCTGAGGTCATGTAGCTGGG + Intronic
1171568860 20:26225997-26226019 TATTTTAAGGTCATGTCTCTTGG + Intergenic
1172278752 20:33695633-33695655 CTGTCTAAGTTCATGGAACTTGG - Intergenic
1172434335 20:34918283-34918305 TTGCCCAAGGTCATATAGCTAGG + Intronic
1172993355 20:39052087-39052109 TTGTCCAAGGTCATGCAGCCAGG + Intergenic
1173180173 20:40800460-40800482 TTGTCCAAGGTCATGTATGTAGG - Intergenic
1175295071 20:57902860-57902882 TTGCCCAAGGTCATGTGGCTGGG + Intergenic
1178050361 21:28740308-28740330 TTGTCTATGTTCATGTGTTTTGG - Intergenic
1178073034 21:28990334-28990356 TTGCCTAAGCTCATGTAGCCAGG - Intronic
1178797840 21:35761929-35761951 AAGTCTAAGGTCATTTTTCTTGG - Intronic
1178992881 21:37368716-37368738 TGGTCTAAGGTCATACAGCTGGG + Intronic
1180282066 22:10709648-10709670 TATTTTAAGGTCATGTCTCTTGG - Intergenic
1180282391 22:10714608-10714630 ATGCCTAAAGTCATGAATCTAGG + Intergenic
1203239309 22_KI270732v1_random:40804-40826 TATTTTAAGGTCATGTCTCTTGG - Intergenic
949415241 3:3806908-3806930 TTGTCTAGGGTCACCCATCTAGG + Intronic
949541828 3:5038613-5038635 TTGGCTCAGGTCATCCATCTGGG + Intergenic
952073581 3:29669297-29669319 TTGTCTAAGGTTCTGCTTCTAGG + Intronic
952206407 3:31185166-31185188 TTGTCTGAGGTCATGTTGCTAGG + Intergenic
953843602 3:46409379-46409401 TTGTCTAAGATCACATAACTAGG + Exonic
955095700 3:55795747-55795769 TTATCCAAGGTCATGCAGCTAGG - Intronic
955809306 3:62769829-62769851 TTGCCTAAGGTCATGCAGCCTGG - Intronic
956069673 3:65434601-65434623 GTGTCTAGTGTCTTGTATCTTGG - Intronic
956322932 3:68018801-68018823 TTGTTTAAGGTCACCTAGCTTGG + Intronic
957109989 3:75942356-75942378 TATTTTAAGGTCATGTCTCTTGG - Intronic
957110317 3:75947322-75947344 ATGCCTAAAGTCATGAATCTAGG + Intronic
958444231 3:94195093-94195115 TTCTCTGAGGCCATGTAGCTAGG - Intergenic
960004187 3:112765188-112765210 TTGTCTAAGGTCACACAGCTTGG - Intronic
961604037 3:128080448-128080470 TTGGCTGAGGTCATGTTTGTCGG - Intronic
962919812 3:139940335-139940357 TTGTCCAAGATCATCTAACTAGG - Intronic
963097768 3:141563710-141563732 TTGTCTAAGGTCACACAGCTGGG + Intronic
964308777 3:155369985-155370007 TTGTCCAAGGTCATGTAGCAAGG - Intergenic
964431949 3:156616531-156616553 TTATCCAAGGTCACGTAGCTAGG - Intergenic
965185836 3:165461987-165462009 CTGTCAAAGGACATGTATGTGGG + Intergenic
965678755 3:171229062-171229084 TTGCCTAAGGTCATGCAGCTAGG - Intronic
966240448 3:177749920-177749942 TTTTCTATGTTCATGTCTCTGGG - Intergenic
970790043 4:19846562-19846584 TTGTTTAAAGAAATGTATCTAGG + Intergenic
971057405 4:22929116-22929138 TTGGCCAAGGTCACGTAACTGGG + Intergenic
973126119 4:46586946-46586968 TTGCCTAATGTCAAGTTTCTTGG + Intergenic
974783796 4:66590898-66590920 TTTTCTAAGGTAATTAATCTTGG + Intergenic
974915129 4:68170168-68170190 TTGTTTAAGTTCATATAGCTTGG + Intergenic
975614816 4:76235573-76235595 TTGTCCAAGATCATGAAGCTAGG + Intronic
976855202 4:89596260-89596282 TTATTCAAGGTTATGTATCTGGG + Intergenic
978908608 4:114039094-114039116 TTGTTTAATCTCATGTTTCTGGG + Intergenic
979839367 4:125419072-125419094 TTGTTGAAGGTCATATAGCTGGG - Intronic
982025288 4:151246960-151246982 TTGCCCAAGGTCATGGAGCTAGG + Intronic
982888237 4:160811314-160811336 TTGTTTAAGGTCACATATCTGGG + Intergenic
983523112 4:168731394-168731416 TTATCTAAGGTCATCTAGCTTGG - Intronic
983622779 4:169777352-169777374 TTGTCTGCGATCATGAATCTTGG - Intergenic
986411700 5:7487715-7487737 TTGTCTGAGGTCATGGTGCTGGG + Intronic
987761564 5:22169833-22169855 TTGTTTAAGGTCATAGATTTAGG + Intronic
987797847 5:22653219-22653241 TTGTTTAAAGTCATGGGTCTGGG - Intronic
988122959 5:26991613-26991635 TTGTCTCAGGTTTTGTTTCTGGG + Intronic
988571149 5:32367907-32367929 TTGTCCAAGGTCATGTAGCTAGG + Intronic
988734410 5:34006635-34006657 TTGTCCAAGGTCTTGTAATTAGG - Intronic
989151970 5:38308512-38308534 TTGCTTAAGGTCATGCAGCTAGG - Intronic
990277422 5:54212879-54212901 TTGGCTAAGGTCATAAAACTGGG - Intronic
990358037 5:54989581-54989603 TTGCCTAAGATCACATATCTTGG - Intronic
990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG + Intronic
992986384 5:82234625-82234647 TTGCCCAAGGTCATTTAACTTGG - Intronic
993776362 5:92002955-92002977 TTGTTTAATGTCATGGCTCTTGG - Intergenic
994320519 5:98389235-98389257 TTGTCTAAAGTCATGCAACTAGG + Intergenic
994691534 5:103025752-103025774 TTGCCCATGGTCATGTAGCTAGG - Intronic
995246461 5:109940785-109940807 GTCTCTAAGGTCATGGAGCTAGG - Intergenic
996301618 5:121993556-121993578 TTGTCCAAGGTCCTATAACTGGG - Intronic
997182921 5:131850692-131850714 TTGTTTTAGGTCTTGTATTTAGG - Intronic
998852463 5:146364270-146364292 TTATCCAAGGTCACATATCTAGG + Intergenic
999351953 5:150880565-150880587 TCCTCCTAGGTCATGTATCTAGG + Intronic
1000362312 5:160459184-160459206 TCGTTTAAGGTCATGTAGCTCGG + Intergenic
1000961194 5:167603278-167603300 TTGTTTAATGTCATCTATTTGGG + Intronic
1001205711 5:169761136-169761158 TTTTCTAAGGTTATGCAGCTAGG - Intronic
1001645479 5:173278597-173278619 CTCTCTGATGTCATGTATCTCGG - Intergenic
1002796361 6:474137-474159 ATGCCCAAGGTCATGTAACTAGG - Intergenic
1003865568 6:10359464-10359486 TTGTCTAAAGTCATGCAGCTAGG + Intergenic
1004021441 6:11779514-11779536 ATGTCTAAAGTCAGGTATTTTGG - Intronic
1006525466 6:34600955-34600977 TTGCCCAAGGTCATGTACCGGGG - Intronic
1006845891 6:37061303-37061325 GTGTTTAAGGTCATGCAGCTGGG + Intergenic
1006892327 6:37439549-37439571 TTGATTAAGGTCATGAATCTGGG - Intronic
1006899724 6:37492126-37492148 TTGCCCAAGGTCGTGTAACTGGG + Intronic
1007097253 6:39221111-39221133 TTGTCTGAGGCTATGTAGCTAGG - Intronic
1007219024 6:40264020-40264042 TTCTTCAAGGTCATGTGTCTGGG + Intergenic
1008713492 6:54258799-54258821 TTGTCTAAAGTCAAATAGCTAGG + Intronic
1009796721 6:68478879-68478901 TTGCCCAAGGTCATATAACTAGG + Intergenic
1010297454 6:74216624-74216646 TTGTCAAAGGTCATGGATGGAGG - Intergenic
1010421031 6:75675592-75675614 TTATCAAAGGGCATATATCTTGG + Intronic
1010687791 6:78872313-78872335 TTGTCTTAGGATATGTTTCTAGG + Intronic
1011815164 6:91181094-91181116 TTGTCCAAGGTCATGCAGCCAGG + Intergenic
1013202059 6:107907666-107907688 TTGTCCTAGGTCATTTAGCTAGG - Intronic
1015555425 6:134456438-134456460 TTGCCCGAGGGCATGTATCTGGG - Intergenic
1015766053 6:136718086-136718108 TTGCCTAAGGTGATATAGCTAGG - Intronic
1022622066 7:31994755-31994777 TTGCCTAAGGTTATGAAACTTGG - Intronic
1022658349 7:32341790-32341812 TTGCATGAGGTCATGTAGCTTGG + Intergenic
1023239910 7:38133162-38133184 TTGTCTAAGGTTTTCTGTCTAGG - Intergenic
1023558906 7:41451808-41451830 TTATCTAAGGTCAAATAACTAGG - Intergenic
1024661300 7:51497761-51497783 TTGACTAAGGGCATATATCTAGG + Intergenic
1026176148 7:67998908-67998930 TTGCCCAAGGTCACATATCTGGG - Intergenic
1026670747 7:72388745-72388767 GTGTCTGTGGTCATGTATGTGGG - Intronic
1028217640 7:88154137-88154159 TTGTCCGAAGTCATGTATATGGG + Intronic
1028246680 7:88487482-88487504 TTTTCTAAGGTCACATATGTGGG + Intergenic
1028688060 7:93615138-93615160 TTGGCCAAGGTCATATAGCTAGG + Intronic
1028799481 7:94946495-94946517 TTTTTTCAGGTCATGTGTCTAGG + Intronic
1031069254 7:117143630-117143652 TTGTTAAAGGTCATGTAACAAGG + Intronic
1031114307 7:117650983-117651005 TTGTCCAAGGTCACTTAGCTAGG - Intronic
1032489392 7:132312692-132312714 TTCCCAAAGGTCATGTAGCTAGG - Intronic
1035693486 8:1575323-1575345 TTGTTTTAGGTCCTGTATTTAGG - Intronic
1035956654 8:4088039-4088061 TTGTCAAAGGTCATGGTGCTGGG - Intronic
1037106622 8:15116508-15116530 TTGTCAAAGGTCTTTTAGCTGGG + Intronic
1039075467 8:33687217-33687239 TTGCCCAAGGTGATGAATCTGGG + Intergenic
1043943608 8:86225116-86225138 TTGTTTAAGTTAATGTATGTGGG + Intronic
1044347733 8:91125445-91125467 AAATCTTAGGTCATGTATCTTGG + Intronic
1045109595 8:98927639-98927661 TTGTCTAAGATCATACACCTAGG + Intronic
1046448531 8:114357625-114357647 TTTTCTGAGGTCATGTTTCCTGG - Intergenic
1046478908 8:114787480-114787502 TTGTATTAGGTGATGTATATTGG + Intergenic
1047040205 8:120985476-120985498 TTTTCTAAAAACATGTATCTTGG - Intergenic
1048387320 8:133924295-133924317 ATGTCTAAGGTCACATATCTAGG + Intergenic
1048394903 8:134004834-134004856 TTTTCTAAGGTCATACATCCAGG + Intergenic
1048531345 8:135253212-135253234 TTGCCCAAGGTCATGTGGCTGGG + Intergenic
1048768940 8:137874398-137874420 TGTTCTAAGGTCTTCTATCTAGG + Intergenic
1049208138 8:141372869-141372891 TTGCCCAAGGTCATGCAGCTAGG + Intergenic
1050044195 9:1526413-1526435 TTGCCTAAGGTCATATTTCTAGG - Intergenic
1050537541 9:6644213-6644235 TTGCCTAAGGTCGTGCAACTGGG - Intronic
1051026230 9:12615062-12615084 TTGTCTAAGGTCATGGAGCTAGG - Intergenic
1052193666 9:25686395-25686417 ATGTCCAAGGTCATATATCTGGG - Intergenic
1052359889 9:27542265-27542287 TTGTCTAAGGTCACACAGCTAGG + Intergenic
1052374028 9:27697646-27697668 TTGTCAAAGTACATGGATCTTGG - Intergenic
1054709251 9:68494657-68494679 TTGCCTAAGGTCATACATCTGGG + Intronic
1059520336 9:114934700-114934722 TTGTCTGGGGCCATGTAGCTGGG + Intergenic
1061516854 9:131095180-131095202 TCGCCTAAGGTCATGCAGCTTGG + Intergenic
1185892138 X:3831213-3831235 TTCTCCAGGGGCATGTATCTAGG + Intronic
1185897245 X:3869627-3869649 TTCTCCAGGGGCATGTATCTAGG + Intergenic
1185902364 X:3908059-3908081 TTCTCCAGGGGCATGTATCTAGG + Intergenic
1186703681 X:12118961-12118983 AACTCTAAGGTCATGTATCTGGG - Intergenic
1189198364 X:39170455-39170477 TTGGCCAAGGTCACCTATCTAGG + Intergenic
1190470941 X:50778861-50778883 GTGCCTAAGGTCATGTAGCTGGG - Intronic
1191868038 X:65721654-65721676 CTGTTTAAGGTCATATAGCTAGG + Intronic
1192226876 X:69234969-69234991 TTGCCCAAGGTCATATAGCTAGG - Intergenic
1192300800 X:69899957-69899979 TTGTCTAAGGTCATACCACTAGG - Intronic
1192444025 X:71196768-71196790 ATGTCTAAGGTCACATAACTGGG - Intergenic
1193078467 X:77381188-77381210 TTGTCTAACATCAAGTATCAAGG + Intergenic
1194485598 X:94481988-94482010 TTGTTTAAGATTATCTATCTTGG + Intergenic
1196153450 X:112401061-112401083 TTGTCTGACGTCAAATATCTTGG + Intergenic
1196636265 X:118006424-118006446 TTGTCCAAGTTCATGTAGCAAGG - Intronic
1197615183 X:128682650-128682672 TTGCCTAAGATCTTGTAGCTAGG - Intergenic
1197718248 X:129726042-129726064 TTGCCTAAGGTCATATAGTTAGG - Intergenic
1197976685 X:132173056-132173078 TTGCCTAAGGTCACATAACTAGG + Intergenic
1198447588 X:136733763-136733785 TTATCTCAGGTCATGCAGCTAGG + Intronic
1198599966 X:138271805-138271827 TTGTCCAAGGTCATGCAGCTAGG - Intergenic
1198617730 X:138478023-138478045 TTGTCTTAGGTCCTGGATCCTGG - Intergenic
1199667609 X:150113111-150113133 TTGTCTAAGGTAATGAAGCCAGG + Intergenic
1200736722 Y:6806778-6806800 TTTACTAAGGTCATGTAGCCAGG + Intergenic