ID: 1086624411

View in Genome Browser
Species Human (GRCh38)
Location 11:88929185-88929207
Sequence CAGCCTGCACTCCCATGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 0, 2: 3, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086624409_1086624411 -2 Left 1086624409 11:88929164-88929186 CCTTGGTTCTGGCTTATTGGTCA 0: 2
1: 0
2: 0
3: 11
4: 113
Right 1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG 0: 2
1: 0
2: 3
3: 10
4: 137
1086624406_1086624411 10 Left 1086624406 11:88929152-88929174 CCTCTGATAGGTCCTTGGTTCTG 0: 2
1: 0
2: 0
3: 10
4: 140
Right 1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG 0: 2
1: 0
2: 3
3: 10
4: 137
1086624404_1086624411 21 Left 1086624404 11:88929141-88929163 CCTACAATCTACCTCTGATAGGT 0: 1
1: 1
2: 0
3: 8
4: 55
Right 1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG 0: 2
1: 0
2: 3
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086624411 Original CRISPR CAGCCTGCACTCCCATGGAT AGG Intronic
900197058 1:1381778-1381800 CAGCATGGAGTCCCAGGGATGGG + Intergenic
901636323 1:10671926-10671948 CAGCCTGGACTGCCCTGGAGAGG + Intronic
906710943 1:47929640-47929662 TAGACTGCACTCCCAGGGGTCGG + Intronic
908829434 1:68164612-68164634 CAGCCTACACTCCTATAGAGGGG + Intronic
909272825 1:73645815-73645837 CAGCCTGCATTCCCACAGTTTGG + Intergenic
916037091 1:160932014-160932036 CAGTCTGCCCACCCAGGGATCGG - Intergenic
923256303 1:232224317-232224339 CAGCCTGCATTCCAAGGGATGGG - Intergenic
1066351352 10:34640195-34640217 CAGCCTCCAGGCCCAGGGATGGG - Intronic
1067737337 10:48868211-48868233 CAGGCTGCACATCCATGAATGGG - Intronic
1069071988 10:63998641-63998663 CAGACTGCACTCCCATGCATTGG - Intergenic
1070613377 10:77949784-77949806 CAGTCTGTTCTCCCAGGGATGGG - Intergenic
1073139886 10:101240031-101240053 CAGCCCCCACTCCCAGGGATGGG - Intergenic
1073485091 10:103812230-103812252 CAGCAGGCACTCCAATGGAGAGG + Intronic
1075650855 10:124127801-124127823 AAGCCTGCACCCCCTTGGTTGGG - Intergenic
1076778153 10:132709475-132709497 CAGCCTGCACTGCCTGGGGTGGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077177834 11:1198641-1198663 CACGCTGCACCCCCTTGGATGGG - Intronic
1077540513 11:3144516-3144538 CAGCCCGCACTCCCCTGCAGAGG - Intronic
1077615338 11:3670001-3670023 CACCCTCCACTCCCAGGGCTGGG + Intronic
1078461715 11:11519771-11519793 CTGCTTGCAGTCTCATGGATGGG - Intronic
1081527573 11:43937030-43937052 CTCCCTCCACTCCCCTGGATGGG - Intronic
1082224634 11:49689994-49690016 CAGCCTGCACTCCCATGGATAGG - Intergenic
1083644955 11:64166555-64166577 CAGCCTGCCCTCCTAGGGACAGG + Intergenic
1083990030 11:66241324-66241346 CAGCCTGCCCTCCCGGGGACTGG + Intronic
1084146686 11:67268720-67268742 CCGCCATCACTACCATGGATGGG - Intronic
1084656982 11:70525434-70525456 CAGCCAGCAGGCCCAGGGATGGG + Intronic
1085396270 11:76208669-76208691 CAGCCTGGTCTCCCAGGGAGAGG + Intronic
1086624411 11:88929185-88929207 CAGCCTGCACTCCCATGGATAGG + Intronic
1089300972 11:117498358-117498380 CAGACTGTCCTCCCACGGATGGG - Intronic
1096258872 12:50078725-50078747 CCGCCTGCACCCCCAGGGATGGG + Intronic
1096384715 12:51187569-51187591 CACCCTGCACCCCCATGCCTGGG + Exonic
1103234160 12:119358310-119358332 AAGCCTCCACCCTCATGGATGGG + Intronic
1107335315 13:39348470-39348492 CAGCCTGAACTCACAGGGCTGGG - Intronic
1109986510 13:69993382-69993404 CAGCCTGCATTCCATGGGATTGG + Intronic
1110103668 13:71642697-71642719 AAGACTGAACTCCCATGGATTGG + Intronic
1111794835 13:92905381-92905403 CTACCTTCACTCCCTTGGATGGG - Intergenic
1115741918 14:36397851-36397873 CACCCAGCCATCCCATGGATGGG + Intergenic
1117071781 14:52064041-52064063 CAGTCTGAACTCTCTTGGATGGG + Intronic
1118152056 14:63200194-63200216 CAGGCTGAACTTCCGTGGATTGG - Intergenic
1118466962 14:66039850-66039872 CAGTTTGCATTCCCATGGACTGG + Intergenic
1120077920 14:80181253-80181275 AAGCCTGCCCTCACATGGGTTGG + Intergenic
1124649021 15:31461407-31461429 CAGTCTGCATTCCAAGGGATGGG + Intergenic
1134431441 16:14211531-14211553 CACCCTGCACTTCCAAGCATGGG - Intronic
1135047153 16:19165352-19165374 CAGCCTGCATTCCAAGGGATAGG - Intronic
1136499512 16:30663033-30663055 CAGCCTGGATTCCCCTGCATGGG - Intronic
1138243257 16:55446071-55446093 CTGCCCCCACTCCCTTGGATGGG - Intronic
1138697539 16:58829381-58829403 CAGACTACACTCCCACAGATGGG - Intergenic
1139953579 16:70683193-70683215 CAGCCTCCAATCCCAGGGAGTGG + Intronic
1141698933 16:85633625-85633647 CAGCCTGGACTGCCCTGGAGAGG + Intronic
1143773120 17:9180832-9180854 CAACCTGCTCTGCCCTGGATGGG - Intronic
1143881155 17:10031095-10031117 CAGCCTTCAGGCCCATGGCTGGG - Intronic
1145332968 17:21888307-21888329 TGGCCTGGACTCCAATGGATTGG + Intergenic
1148186955 17:45651153-45651175 CAGCCTGCCCTCCCCTGGATCGG + Intergenic
1151598128 17:75090284-75090306 CAGCCTCCCCTCCCATCGAGCGG - Intronic
1151980474 17:77505453-77505475 CTGCCTTCAGGCCCATGGATGGG + Intergenic
1152373390 17:79904580-79904602 CAGGCTGCATTCACATGGAATGG - Intergenic
1152633352 17:81420501-81420523 CAGACTGGCCTCCCAGGGATGGG + Intronic
1153758917 18:8311450-8311472 CAGGCTGCAGTCCCATGTGTGGG - Intronic
1157805626 18:50655543-50655565 CAGCCTGCACTCCTCTGGGGTGG + Intronic
1158302618 18:56068464-56068486 CAGCCTGCACTTCCACCAATGGG + Intergenic
1158491229 18:57911316-57911338 CTGCCTGAAGTCCCATGGCTGGG - Intergenic
1160492300 18:79348530-79348552 CAGGCTGCCCTCCCCTGGCTGGG + Intronic
1161405906 19:4090963-4090985 CAGCCTGCGCTCCCAGGGGAGGG + Intronic
1162779183 19:12997716-12997738 GAGCCTGCTCCCCCATGGCTTGG + Intronic
1163104503 19:15115699-15115721 CAGCCTTCAGCCCCATGGCTTGG + Intronic
1163532793 19:17860463-17860485 GAACCTGGACTCCCATGGAGTGG + Intronic
1164398736 19:27888325-27888347 CAGCCTGCAATCCCAGGCCTGGG - Intergenic
1165495677 19:36151002-36151024 CAGCTTGTACTCCCTTGGCTGGG - Exonic
1166935398 19:46329445-46329467 CAGCATCCTCTCCCATGGCTGGG + Exonic
931537670 2:63297265-63297287 CAGCCTGCATTCCAAGGGGTGGG + Intronic
931848971 2:66234203-66234225 CAACCTGCATTCCAAGGGATAGG - Intergenic
932474291 2:71991829-71991851 AAGACTGTATTCCCATGGATGGG - Intergenic
937374555 2:121326826-121326848 TAGGCTCCACTCTCATGGATGGG - Intergenic
939563087 2:143754648-143754670 CAGCCTGCACTCCCAGGGAACGG + Intronic
941857962 2:170249522-170249544 CTGTCTGCACTCCAAGGGATTGG - Intronic
942605972 2:177691369-177691391 CACCCTGCACTCCCAGTGGTGGG + Intronic
943783165 2:191846910-191846932 CAGCGTCCTCTCCCATGGCTAGG + Exonic
944226524 2:197354414-197354436 CAACCTGCATTCCAAGGGATGGG - Intergenic
945034664 2:205694392-205694414 CAGCCTTCCCTCCCAGGTATAGG + Intronic
946978301 2:225177711-225177733 CAGGCTCCACCCTCATGGATGGG - Intergenic
948721540 2:239904017-239904039 CAGCCTGGGCTCCCTGGGATGGG - Intronic
1170109956 20:12794475-12794497 CAGCCTGCATTCCAAGGAATGGG + Intergenic
1171980160 20:31622330-31622352 AAGCCTGTACTCCCAGGTATTGG + Intergenic
1172115084 20:32568845-32568867 CAGCCTGCAGTCCCATCAAGGGG - Intronic
1172754124 20:37271405-37271427 CAGCTTGATTTCCCATGGATTGG + Intergenic
1173793644 20:45843801-45843823 CAGTCTGCACACCCATGCACGGG - Intronic
1176657284 21:9598486-9598508 GAAACTGAACTCCCATGGATAGG - Intergenic
1177379056 21:20314452-20314474 CAGCCTGCATTCCAAGGAATGGG - Intergenic
1179540787 21:42082292-42082314 CAGGCTGCAGTCCCAGGGACTGG - Intronic
1180594871 22:16966541-16966563 CAGCCAGGAACCCCATGGATGGG + Intronic
1181049886 22:20233479-20233501 CAGCGGGCACCCCCATGGACAGG + Intergenic
1181747915 22:24968522-24968544 CAGCATCCACACCCATGGAATGG + Intronic
1184775734 22:46621780-46621802 CAGCCTTCACCACCAGGGATGGG - Intronic
950478111 3:13226896-13226918 CAGCCTCCACCCCCAAGGACTGG + Intergenic
950494159 3:13323872-13323894 CTCCCTGCACTCCCTTGGCTAGG + Intronic
950556238 3:13697713-13697735 CAGCCACCACTCCCATGGAGTGG - Intergenic
951098769 3:18662499-18662521 CACCCTGCATGCTCATGGATAGG - Intergenic
952903627 3:38125942-38125964 CAGCCTGTAGGCCCATGGATGGG - Intronic
953030378 3:39176040-39176062 CAGTCTGAACTCACATGGGTTGG - Intergenic
957143167 3:76387192-76387214 GAGCCTCCGCCCCCATGGATGGG - Intronic
958481126 3:94647339-94647361 CAGACTGCACGCCCATTCATAGG - Intergenic
960148962 3:114232087-114232109 CAGACTGCAGTCCCATGGGGCGG - Intergenic
962224840 3:133597238-133597260 CAGCCTGCATTCCAAGGAATGGG + Intergenic
962251800 3:133840333-133840355 CAGCCTGCACACCCAAGGGGAGG + Intronic
966567665 3:181401141-181401163 GAGCCTCCTCTCCCAGGGATAGG - Intergenic
967953998 3:194863144-194863166 CAGCCTGCATTGGCATGGACTGG - Intergenic
970447918 4:16139656-16139678 CAGCCTGCACCCCCAGAGACTGG + Intergenic
976813076 4:89117975-89117997 CAGCCAGCATTCCCAGAGATGGG - Intergenic
978714518 4:111825371-111825393 TGGCTTGCACTCCCATTGATGGG - Intergenic
981663409 4:147194305-147194327 CACCCAGCTGTCCCATGGATTGG + Intergenic
981671258 4:147289605-147289627 CAGCCTAGACTCCCTAGGATGGG + Intergenic
985052955 4:186011004-186011026 CAGACTGCATTGCAATGGATCGG - Intergenic
985418141 4:189757643-189757665 GAAACTGAACTCCCATGGATAGG + Intergenic
992038904 5:72809019-72809041 AAGCGTGCACTCCCCTGGAAAGG - Intergenic
992620695 5:78589615-78589637 CAACCTGCACCCGCATGAATAGG + Intronic
992785880 5:80170236-80170258 CAGACTGCAATTCCATGGACAGG + Intronic
997527807 5:134564696-134564718 CAGTCTGCAGCCCCATGGAGGGG - Intronic
1000326657 5:160177482-160177504 AAGCCAGCACTCCCATGTTTGGG - Intergenic
1002055119 5:176594332-176594354 CCCCCTGCTCTCCCATGGCTGGG + Intronic
1002469592 5:179427541-179427563 CAGCCTTCACTCTGATGGACTGG - Intergenic
1003727269 6:8779506-8779528 CATCCTGCTCTCCCATGTTTCGG + Intergenic
1006917222 6:37602388-37602410 CACCCTGCACAGCCCTGGATGGG - Intergenic
1007059327 6:38923101-38923123 CCGCCTCCACTCTCATCGATGGG + Exonic
1012175287 6:96074183-96074205 CAGGCTGCATTCTCAGGGATGGG - Intronic
1012445451 6:99302697-99302719 CAGCCTACACTCACAGGGAGAGG + Intronic
1015325527 6:131919042-131919064 CAGACTACACTCCCATGCACTGG - Intergenic
1015425192 6:133056917-133056939 CAGCCTGCATCCCTATGGAGTGG - Intergenic
1018682012 6:166272125-166272147 CAGCCTGCGCTCCAAGGGCTGGG + Intergenic
1019570088 7:1707286-1707308 CAGCCTGCAGTCACGTGGAGGGG - Intronic
1020721784 7:11754338-11754360 CAGCCTGCACCACAATGGAGAGG + Intronic
1021405941 7:20267401-20267423 CAACCCCCACTCCCATTGATTGG + Intergenic
1024716344 7:52083506-52083528 AGGGCTGCACTCCCATGGATGGG - Intergenic
1025236637 7:57239243-57239265 CTGCCTGCACTCCCAGGACTCGG + Intergenic
1031205977 7:118758032-118758054 CAGCCTGCATTCCATGGGATGGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1036544972 8:9759154-9759176 CAGCCTGCACTCCAGGGGAGGGG + Intronic
1040540319 8:48347834-48347856 CAGACTGCACTCCCTTGCACTGG - Intergenic
1041257839 8:55994791-55994813 AAGGCTGCACTACCATGGAGTGG + Intronic
1041680612 8:60585885-60585907 CAGTCTGCATTTCCATGGACAGG + Intronic
1044618798 8:94168813-94168835 CAGCCTGCACTCAACAGGATGGG - Intronic
1050602536 9:7267303-7267325 CTGCCTGCACGCCCAGGGATGGG + Intergenic
1053471174 9:38346980-38347002 AAGGCTGCACTCCCAGGGAGGGG + Intergenic
1055414443 9:76065158-76065180 CATCCAGCAATCCCATGGCTGGG - Intronic
1059013848 9:110493012-110493034 CAGCCTGCACTCCCAGTTGTTGG + Intronic
1060735322 9:126063081-126063103 CAACCTGCAGACCCATGGGTGGG + Intergenic
1061042030 9:128145906-128145928 CAGCCTGTCCTCCCATGGAGAGG - Intergenic
1203635006 Un_KI270750v1:102060-102082 GAAACTGAACTCCCATGGATAGG - Intergenic
1186261205 X:7781773-7781795 CAGCCTACCCTCACATGGCTGGG + Intergenic
1189506949 X:41621265-41621287 CAGCCTGCACTCCAGGGGAGGGG - Intronic
1190249261 X:48709732-48709754 CAGCCTGGACTGGCTTGGATTGG + Intergenic
1196101359 X:111850515-111850537 CAGCCTGGACTTCTGTGGATGGG + Intronic
1197309187 X:124883481-124883503 CAGCATGCACTGCCTTGAATGGG - Intronic