ID: 1086629749

View in Genome Browser
Species Human (GRCh38)
Location 11:89003028-89003050
Sequence CTTGTCATGAGAAAAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086629749_1086629750 13 Left 1086629749 11:89003028-89003050 CCAAAAATTTTTCTCATGACAAG 0: 1
1: 1
2: 3
3: 29
4: 344
Right 1086629750 11:89003064-89003086 CTCAACAAAAACATGTTAAATGG 0: 1
1: 1
2: 4
3: 78
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086629749 Original CRISPR CTTGTCATGAGAAAAATTTT TGG (reversed) Intronic
905059998 1:35132038-35132060 GTTGGGATGACAAAAATTTTTGG + Intergenic
906235536 1:44205909-44205931 CTTATCTTGAGCCAAATTTTAGG - Intergenic
906901341 1:49839899-49839921 CTGGTCAGGACAAAAATTTTGGG + Intronic
907895170 1:58681631-58681653 CTTGTAATGAAAAAAAGCTTTGG - Intronic
908953989 1:69598749-69598771 TTTGTATTGAGAAACATTTTTGG - Intronic
909737847 1:78987542-78987564 ACTGTACTGAGAAAAATTTTAGG + Intronic
909795090 1:79724520-79724542 TTTGTCATTTCAAAAATTTTAGG - Intergenic
911411558 1:97515726-97515748 CTTATCAAGAGAGAAAGTTTTGG + Exonic
915189631 1:154138046-154138068 CTTGTCAGCAGAAAAGATTTGGG + Intronic
917130736 1:171739723-171739745 CTTGTGAGGAGAAATCTTTTGGG + Intronic
918467926 1:184840523-184840545 ATTGTTCTGAGATAAATTTTTGG + Intronic
918477369 1:184939640-184939662 CTTGTCACCAGAAAAACTGTGGG + Intronic
918770526 1:188552525-188552547 ATAGACATAAGAAAAATTTTAGG + Intergenic
919367201 1:196676919-196676941 CTTGTTAAAATAAAAATTTTAGG - Intronic
919424345 1:197411106-197411128 CATGTCATTAGAGAAATTATTGG - Intronic
922635513 1:227166614-227166636 GTAGTCATAAGAAAAATGTTTGG + Intronic
922711619 1:227838080-227838102 CTTTTGATGGGAAAAAGTTTTGG + Intronic
922868399 1:228880460-228880482 CTTATAATGAGAAATATATTTGG - Intergenic
923905964 1:238383979-238384001 CTTATCATGAGAAAAACATCAGG - Intergenic
924018694 1:239757041-239757063 ATTGTCAAGTGAAAAATTTGAGG - Intronic
924040275 1:239977938-239977960 ATTGGCATAAGTAAAATTTTAGG + Intergenic
924257450 1:242196484-242196506 CTTGCAATGAGAAATATTTAGGG - Intronic
924299062 1:242618635-242618657 TTGGTCATGAGGAAACTTTTGGG - Intergenic
1063189676 10:3681637-3681659 CTTAACATGTGAAAAATTTTAGG + Intergenic
1063388545 10:5632881-5632903 CTTGTTATTAGAAATATTATTGG + Intergenic
1064089247 10:12369386-12369408 CTTGTCCTGAGGGAACTTTTTGG + Intronic
1068230181 10:54161419-54161441 GTGGTCATGAGTAAAGTTTTGGG + Intronic
1068276841 10:54811258-54811280 TTTTTCCTGAGAAAAATTTATGG + Intronic
1068741737 10:60481255-60481277 ATTGTCATGATGAAGATTTTTGG + Intronic
1069161495 10:65099079-65099101 CTAATCATGAGAAAAATATTAGG - Intergenic
1069197225 10:65567870-65567892 CATGACATCAGAAAAATCTTTGG - Intergenic
1070091526 10:73290423-73290445 CTGGGCATGAGGAAAATTTTAGG + Intronic
1070124781 10:73612412-73612434 CTTGACATGAGGAAAATTCTAGG - Intronic
1070273997 10:74986992-74987014 CTAGTTCTGAGTAAAATTTTGGG - Intronic
1071430723 10:85604275-85604297 CTTGTCCTGGGAAAGATTCTAGG - Intronic
1072019353 10:91382879-91382901 CTTGACATTATAAACATTTTGGG - Intergenic
1072210406 10:93241126-93241148 TTTTTAATGAGAAATATTTTTGG + Intergenic
1074331645 10:112517714-112517736 CTAGTCATGAGAAAAATATCAGG + Intronic
1076127204 10:127984458-127984480 CGTGTCAAGAGAAAGATTTCTGG - Intronic
1077321131 11:1942561-1942583 CAGGGCACGAGAAAAATTTTGGG + Intergenic
1077979364 11:7284938-7284960 CTTGTAAAGAGAAAAAATTATGG - Intronic
1078969638 11:16392979-16393001 CTTGTCATTAGAAAGAATTAGGG - Intronic
1079221468 11:18565444-18565466 CATATCATGAAAAAAAGTTTGGG + Intronic
1080577178 11:33610625-33610647 CTTGTCATTAATAAACTTTTGGG - Intronic
1081098997 11:38978413-38978435 ATTGCCATGGGATAAATTTTGGG - Intergenic
1082059355 11:47847375-47847397 CTTTTCATGGGGAAATTTTTTGG - Intronic
1082183099 11:49144289-49144311 GTTGTCATGAGAAAAGATTTTGG + Intergenic
1082219876 11:49621758-49621780 CTTGTCATGAGAAGAATTTTTGG + Intergenic
1083096675 11:60258065-60258087 CTAATCATGAGAAAAATATCAGG - Intergenic
1083523123 11:63334463-63334485 AGTGTCATGAGGAAAATTTATGG - Intronic
1084463611 11:69309572-69309594 CTTGGCCAGAGAAAAATTCTGGG + Intronic
1086629749 11:89003028-89003050 CTTGTCATGAGAAAAATTTTTGG - Intronic
1086699253 11:89881439-89881461 GTTGTCATGAGAAAAGATTTTGG + Intergenic
1086706919 11:89963071-89963093 GTTGTCATGAGAAAAGATTTTGG - Intergenic
1086747047 11:90441777-90441799 TTTGTCATGGCTAAAATTTTAGG + Intergenic
1087085322 11:94212467-94212489 CTTATCATGAGAAAATTTTCTGG - Intergenic
1087521341 11:99240593-99240615 CTTATTATGAAAAAAATTTCTGG + Intronic
1087731810 11:101787333-101787355 ACTGTCCTGAGAAAAATGTTGGG + Intronic
1088330284 11:108644060-108644082 ACTGTCCTGAGAAAAATATTAGG - Intergenic
1088677352 11:112207590-112207612 CTTTTCAAAAGAAAAATATTAGG - Intronic
1089726225 11:120482792-120482814 GATGTCATGAGGAAAATGTTTGG - Intronic
1090212315 11:124930020-124930042 CTTTTCATCTGAAAAGTTTTTGG + Intronic
1091464016 12:668146-668168 TATGTAATTAGAAAAATTTTAGG + Intergenic
1091536554 12:1415556-1415578 GTTGCAATGAGAATAATTTTAGG - Intronic
1092667013 12:10812994-10813016 CCTGTAACGACAAAAATTTTTGG + Intergenic
1093345200 12:18033224-18033246 CTACTCAGGAGAAAAATATTTGG - Intergenic
1093354101 12:18141795-18141817 CTTGTCATGAAAATAATTGTGGG - Intronic
1093608669 12:21127013-21127035 CTTGGCTAGAGAAAAAATTTTGG + Intronic
1094220700 12:27990152-27990174 CTTTTCATGATAAAAATTTTTGG + Intergenic
1094692253 12:32781482-32781504 ATTTTCATGAGAAAAGTATTTGG + Intergenic
1096586088 12:52620912-52620934 CTTGTCCTCAGGAAAATTTCTGG - Intergenic
1096659693 12:53116486-53116508 CTTGTCATTCCAAAAATTTTAGG - Intronic
1098877911 12:75885984-75886006 TTTATAATAAGAAAAATTTTGGG - Intergenic
1098881472 12:75921736-75921758 CGTGTTATGAGATAACTTTTAGG - Intergenic
1099222496 12:79932038-79932060 ATTGTCAAGAGAAAAGTTTTAGG - Intronic
1099493878 12:83320524-83320546 CTTGTCAAGAGAAATATTAATGG - Intergenic
1099604801 12:84790056-84790078 ATTGGCATGAGCAAAGTTTTGGG + Intergenic
1100728363 12:97434929-97434951 CTTGTCATTATTAACATTTTGGG + Intergenic
1100974520 12:100108521-100108543 CTTGTCAGGAGATAAATTTTTGG + Exonic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1101745859 12:107541019-107541041 CTTGTCTTGAGAAGGACTTTAGG + Intronic
1101841328 12:108329363-108329385 CTAGACATGAGAGAGATTTTAGG - Intronic
1102421802 12:112809204-112809226 CTTGTCTTGTGAAATATTTGAGG + Intronic
1103297150 12:119897379-119897401 CTAGACTTGAGCAAAATTTTAGG + Intergenic
1106743707 13:32676595-32676617 TTTGTTATGAGAATAATTTGAGG - Intronic
1107055056 13:36094040-36094062 CTAGTCATTAAAAAAATTTTTGG - Intronic
1107947575 13:45433241-45433263 CTTTTCATGAAAAAGAATTTGGG + Intergenic
1108390415 13:49942058-49942080 CTTGTTACTAGAAATATTTTAGG - Intergenic
1108938553 13:55918580-55918602 CTTGTAATCAGAGAAGTTTTGGG - Intergenic
1109182725 13:59233069-59233091 ATTGTGATAAGAAAAATTTTAGG - Intergenic
1109358497 13:61266083-61266105 AGTGTCAGGAGAAAAATTTTAGG - Intergenic
1109711573 13:66167358-66167380 CTTGACATCAGAAACATTATTGG - Intergenic
1109858024 13:68158587-68158609 AGTGTCATGAGATAACTTTTTGG + Intergenic
1109895547 13:68683543-68683565 CATGTAATGAGAAACAATTTTGG + Intergenic
1110192977 13:72752661-72752683 CTTGTGATGTGTAACATTTTTGG - Exonic
1110203344 13:72880388-72880410 CTTGTCATAAGAAAAATAACAGG - Intronic
1110325404 13:74208605-74208627 TCAGTCATCAGAAAAATTTTTGG + Intergenic
1111835741 13:93386393-93386415 CTTGTCAGGAATAAAATTTATGG + Intronic
1111882101 13:93970243-93970265 CCTGTCACGAAAAAAATTTGGGG + Intronic
1111902888 13:94221085-94221107 CTTGTTTTGAAAAAAATTGTTGG - Intronic
1112121003 13:96411350-96411372 GTTCTCATGGGAAATATTTTGGG + Intronic
1113579034 13:111415145-111415167 TTGGTCATTAGAAAAATATTAGG + Intergenic
1115313249 14:32000911-32000933 ATTGTCCTAAGAAAAATCTTTGG + Intergenic
1116096138 14:40371453-40371475 CATTTTATGAAAAAAATTTTGGG - Intergenic
1116352521 14:43882783-43882805 CTTTTCATGATAAGAATCTTTGG - Intergenic
1116897884 14:50334964-50334986 CCTTTCCTGAGAATAATTTTTGG + Intronic
1117365044 14:55018738-55018760 TTTTTAATGAGAAAAATGTTAGG - Intronic
1118806234 14:69239563-69239585 GTTGTCATGAGAAACAATTAAGG - Intronic
1119902239 14:78271385-78271407 CTTGTCATTTAAAATATTTTTGG - Intronic
1120316644 14:82902737-82902759 CTTGTCATGGGACAAATTTTGGG + Intergenic
1120555039 14:85919313-85919335 ATTGTGATGAAAAATATTTTGGG - Intergenic
1120613874 14:86677193-86677215 CTTGTCATGAGACTAAGATTTGG + Intergenic
1120963177 14:90143602-90143624 CTTGTGAAAAGAAAAACTTTAGG + Intronic
1121989604 14:98543126-98543148 CGTGTCTTGAGAAAGTTTTTTGG - Intergenic
1122684849 14:103497513-103497535 CTGGTCATTAAAAAAATTTAAGG - Intronic
1124108231 15:26761413-26761435 TTAGTCATAAGAGAAATTTTAGG + Intronic
1125148307 15:36499788-36499810 TTTCTCTTGAGAAAAAGTTTAGG + Intergenic
1125842676 15:42819071-42819093 CTTTTCATTAGTATAATTTTTGG + Intronic
1126268281 15:46780854-46780876 CTGGCCATCAGAAAAATCTTAGG - Intergenic
1126352848 15:47763247-47763269 CTTATCATGAGAATAATTGCTGG + Intronic
1126992555 15:54398144-54398166 CCTTTCATGATAAAAACTTTCGG - Intronic
1128011894 15:64305035-64305057 CTTATAAGGAGAAAGATTTTTGG - Intronic
1130676955 15:85961272-85961294 TTTCTCATGACAGAAATTTTGGG + Intergenic
1130737806 15:86568882-86568904 ATTGTCATTAAAAAAATTTCTGG - Intronic
1131913238 15:97232348-97232370 CTTGATATGAGAAAAATATATGG - Intergenic
1132422810 15:101688290-101688312 CTTTTCAAGAGAAAAAGTTGGGG + Intronic
1133309218 16:4832192-4832214 CTTGTCATCAGAAGAATTGTGGG + Exonic
1135058131 16:19247941-19247963 CATGCCCTGAGAGAAATTTTTGG + Intronic
1135554638 16:23425732-23425754 TTTGCCATGAGGAAAACTTTGGG - Intronic
1139135579 16:64200550-64200572 CCAGTAATGAGAAAAATGTTAGG - Intergenic
1140025434 16:71285807-71285829 CTTGCCATAAGAAAAGTTCTTGG + Exonic
1140174842 16:72647897-72647919 CTTGTCTTGAGAAATGTATTAGG - Intergenic
1140214266 16:72994812-72994834 CCTGCCAAGAGAATAATTTTAGG - Intronic
1144297406 17:13889147-13889169 CTTATCATGAGGAAACCTTTTGG - Intergenic
1147203958 17:38823549-38823571 CTTGGCATGTGGAAAATGTTCGG + Intronic
1150271793 17:63871598-63871620 CTTGTGTTCAGAAGAATTTTAGG - Intergenic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1151962786 17:77415927-77415949 CTTGTCAGGAGCAAAATGTAAGG + Intronic
1153183510 18:2461908-2461930 GTTATTATGAGAACAATTTTAGG - Intergenic
1153484891 18:5587125-5587147 TTTGTAAGGAGAAAAATCTTAGG + Intronic
1153589401 18:6657565-6657587 CTTGTCTTGGGAAAAGTTTTAGG + Intergenic
1155005360 18:21724370-21724392 CATTTAATGAAAAAAATTTTAGG + Intronic
1155118104 18:22790546-22790568 CTTTTAATGAAAAAAATCTTTGG + Intergenic
1155758655 18:29536064-29536086 GTTATTCTGAGAAAAATTTTTGG + Intergenic
1156561110 18:38126836-38126858 CCTGTCATGCAAAACATTTTGGG - Intergenic
1157149628 18:45203456-45203478 CTGCTCATGAGAGAAATTATCGG + Intergenic
1158294809 18:55983937-55983959 CTTTTCCTGGGAAAAATATTAGG + Intergenic
1158589343 18:58766660-58766682 CTTTGCATGAGAAAAATGCTGGG - Intergenic
1160218395 18:76954297-76954319 CATCTCATGAGTAAAATGTTTGG + Intronic
1162186574 19:8909791-8909813 ATTGTCTTGAGAGAAATTCTGGG + Intronic
1163078246 19:14915821-14915843 GTATTCATGAGAAAATTTTTAGG - Intergenic
1166013649 19:39963155-39963177 CCTTTCATAAGGAAAATTTTTGG - Intergenic
1166160044 19:40945762-40945784 CTGGTTAAGAGAAAAACTTTAGG + Intergenic
925394508 2:3523148-3523170 CTGGTCATGAAACATATTTTTGG - Intergenic
926390676 2:12388923-12388945 CTTGAAATTAGGAAAATTTTTGG + Intergenic
927307142 2:21586586-21586608 CTTGTCAGGAGAAAAAAGTAAGG - Intergenic
928524299 2:32123937-32123959 GATAACATGAGAAAAATTTTTGG + Intronic
930580253 2:53202539-53202561 CTTCTCAGGAGAAAAGTCTTTGG + Intergenic
930771624 2:55135702-55135724 CAGGGCATGAGAAAACTTTTTGG - Intergenic
930889311 2:56364523-56364545 CATGTCAGGAGAAAACCTTTTGG + Intronic
930991754 2:57664522-57664544 CTTGTCATTCTAAAAATTCTGGG - Intergenic
932341323 2:70964357-70964379 CTTCTCCTGAGAACAATTTGGGG + Intronic
932850725 2:75182266-75182288 CAGGCCATGAGAGAAATTTTGGG - Intronic
933428750 2:82147312-82147334 CTTGGCAAGAGAAAAATTGGGGG + Intergenic
933505366 2:83170452-83170474 CTAATCTTGAGAAAAATATTGGG + Intergenic
933823009 2:86131678-86131700 CTTATCATAGGAAAAATTTCAGG + Intronic
934586989 2:95509171-95509193 GTTGTCATGAGAAAAGATTTTGG - Intergenic
934592343 2:95567144-95567166 ACTGTTAAGAGAAAAATTTTAGG - Intergenic
935456623 2:103276547-103276569 CATCTCAAGAGAAAAAATTTGGG + Intergenic
935528859 2:104207444-104207466 CATGTCTTGAGAAACACTTTGGG - Intergenic
935677287 2:105606336-105606358 CTTTTCATATGATAAATTTTGGG - Intergenic
938996908 2:136689404-136689426 AATGGCATGAGAAAACTTTTTGG - Intergenic
940599275 2:155837006-155837028 CTTGTCAGGAGAAAAATTAGAGG - Intergenic
940671018 2:156668043-156668065 CTTGTCTCTAAAAAAATTTTTGG - Intergenic
942144774 2:173016150-173016172 TTGGCCATGAGAAAAAATTTTGG - Intronic
942153596 2:173104318-173104340 CTAGTCATGAGGAAAATATCAGG + Intronic
942610813 2:177740850-177740872 CTTGCCATGAGAAAAGTACTAGG - Intronic
943255109 2:185584775-185584797 CTTCTCAAGAGAAACGTTTTAGG + Intergenic
943868549 2:192961437-192961459 CTTGTCATGTGATTAAATTTAGG + Intergenic
943999582 2:194815780-194815802 CTTATTATAAGTAAAATTTTTGG + Intergenic
944426966 2:199594065-199594087 CTTTTTTTGAGAAACATTTTTGG + Intergenic
944941103 2:204628135-204628157 GTTTTCTTGAGCAAAATTTTTGG + Intronic
946214477 2:218173540-218173562 CTTGACAAAAAAAAAATTTTTGG + Intergenic
946900361 2:224366394-224366416 TTTGATATGAGAAAAATATTGGG + Intergenic
947122189 2:226828089-226828111 ATTAGCATGAGAAAACTTTTTGG - Intergenic
947242641 2:228012997-228013019 CATGTCCTGAAAATAATTTTAGG - Intronic
947599778 2:231439517-231439539 CTTCTCTTGAGAAAATATTTAGG + Intergenic
1168784159 20:523080-523102 CTTGTAATGTTGAAAATTTTAGG - Intronic
1169585711 20:7082258-7082280 CTTGTCATCAAAAGAATTTTGGG + Intergenic
1169715183 20:8608019-8608041 CTAGTCATTAAAAAAATTGTTGG - Intronic
1169911908 20:10653771-10653793 CTTGTCATGGGAAAATTATAGGG + Intronic
1170078060 20:12441848-12441870 GTTGATATGAGAAAATTTTTTGG - Intergenic
1173355603 20:42285692-42285714 CTGGGCAAGAGAAAAATTTAAGG + Intronic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1177253799 21:18633086-18633108 ATATTCATGAGAAAAATTTAAGG + Intergenic
1180501856 22:15936896-15936918 CTTTTCATGAAAAAAATTGAAGG + Intergenic
1183804927 22:40200605-40200627 CTTCTCATGATTTAAATTTTAGG - Intronic
951333148 3:21389566-21389588 AATGTCATGAGAAAATTTTATGG + Intergenic
951685872 3:25343843-25343865 CTTGTCATGAGGAAAATACAAGG + Intronic
952713052 3:36451054-36451076 CTTGCCATGAGTGAAATATTTGG + Intronic
953071652 3:39526632-39526654 CTGGTTTTGGGAAAAATTTTGGG + Intronic
953668815 3:44945473-44945495 CATCTCCTCAGAAAAATTTTTGG - Intronic
953994389 3:47508501-47508523 CTAGTCATTATAAAAATTCTTGG - Intronic
956320224 3:67988347-67988369 CTTCTCATTAGCAAAATTGTAGG + Intergenic
958083484 3:88776283-88776305 CTTCTCATTAGAAAATTTATAGG + Intergenic
958913705 3:100024293-100024315 ATTAACATGAGAAAAATGTTAGG - Intronic
959102821 3:102032737-102032759 CTGGTCCTGGGAAGAATTTTGGG + Intergenic
959141188 3:102488123-102488145 CTTTTTATGAGAAAATATTTAGG + Intergenic
959161423 3:102729575-102729597 CTTGACATGAGAAATTTGTTAGG - Intergenic
959636709 3:108581851-108581873 ATTTTCATAAGAAAAATTTATGG - Intronic
959856551 3:111165410-111165432 CATGTCATGTGAACAACTTTTGG - Intronic
960211067 3:114966891-114966913 TTTTTCATGGGAAACATTTTAGG + Intronic
960336393 3:116422610-116422632 GTGGGCATGAAAAAAATTTTGGG + Intronic
964054555 3:152437196-152437218 CTTCTGAGGTGAAAAATTTTCGG + Intronic
965967413 3:174509934-174509956 CTATTCATGATAAATATTTTAGG - Intronic
967673301 3:192265434-192265456 CTTATCATGAGAAATAATTAAGG - Intronic
972584196 4:40421526-40421548 GTTGTCATGACAGACATTTTTGG + Intergenic
973263942 4:48192374-48192396 AGTGGCATGAGAAAACTTTTAGG + Intronic
974504921 4:62757268-62757290 CTTGTCTTAAGAAAATTTGTAGG + Intergenic
975774676 4:77772550-77772572 CTTGTAAGGGGAAAATTTTTTGG - Intronic
976765999 4:88598237-88598259 CTTATCATAAGACAAAGTTTAGG + Intronic
976821856 4:89215759-89215781 CTTTTCATGAAAAGTATTTTTGG + Intergenic
977130069 4:93225185-93225207 CTTATCATGAGATAAATTAAAGG - Intronic
977159662 4:93618030-93618052 CATGTCATGAGTAAACTTTCAGG - Intronic
977218156 4:94307893-94307915 ATTGTGATGTGAAAATTTTTTGG - Intronic
977416590 4:96742091-96742113 CTTATCATTTGGAAAATTTTGGG + Intergenic
977790453 4:101094260-101094282 CTGGTCATGAAAAAAACATTTGG - Intronic
977895129 4:102355545-102355567 ATACTCATAAGAAAAATTTTTGG - Intronic
978717286 4:111860652-111860674 CTTATAATGAGTAAAGTTTTAGG + Intergenic
979518102 4:121634944-121634966 CCTGTCATGAGAAAAACATCAGG - Intergenic
979522245 4:121681105-121681127 CTATTCATGAGACATATTTTAGG + Intronic
979643236 4:123034379-123034401 CCAACCATGAGAAAAATTTTAGG + Intronic
979975849 4:127195573-127195595 CTCGTTATGAGAACAAATTTGGG - Intergenic
980052135 4:128049056-128049078 TTTGTAATTAGAAAAATATTGGG + Intergenic
980178774 4:129378897-129378919 CATGTCATGATAAAAAATTCTGG + Intergenic
980227585 4:130006821-130006843 CTTTTCTTGTGAAAAATTCTTGG - Intergenic
980281127 4:130721188-130721210 TATGTCATGAGAAATATATTTGG - Intergenic
980281264 4:130723631-130723653 CTTATCATAAGTAAACTTTTAGG + Intergenic
980837549 4:138215590-138215612 CTAGTCATTAGAAAAATCTTTGG - Intronic
982067310 4:151665703-151665725 CTTGTCAGGAAAAAAATCATTGG + Intergenic
982375615 4:154687630-154687652 CTTATCATCAGAAATACTTTTGG - Intronic
982747040 4:159114656-159114678 TTTGTTATAAGAAAAATTGTAGG + Intronic
982845715 4:160249362-160249384 CTGGGCATGATAAAATTTTTAGG + Intergenic
983743178 4:171161268-171161290 CTTGTAAAGAAAAAAATTTCTGG + Intergenic
984232158 4:177112445-177112467 ATTGTCAGGAGGCAAATTTTTGG + Intergenic
984415089 4:179447598-179447620 GTTGCCATTAGAAAAATTGTGGG - Intergenic
984555087 4:181203996-181204018 CTTTTCATGAGAAAATATCTTGG + Intergenic
984570876 4:181391954-181391976 GTTATGAAGAGAAAAATTTTTGG - Intergenic
984800404 4:183710584-183710606 CTAGTCATGTTAAAAATGTTAGG - Intronic
986899987 5:12419515-12419537 TTTGTCTTGAGTAAAATTCTGGG - Intergenic
987186626 5:15427246-15427268 CTTGTGATGATGGAAATTTTGGG - Intergenic
987226656 5:15848781-15848803 TTTTTCATGAAATAAATTTTGGG - Intronic
987300695 5:16595559-16595581 CTTTTCATAGGAAGAATTTTTGG - Intronic
987992440 5:25231192-25231214 TTTGTGATTATAAAAATTTTAGG - Intergenic
988058655 5:26136263-26136285 TTTGTCAGTAGAATAATTTTTGG - Intergenic
988103735 5:26716343-26716365 CTTGTGATGAAAATACTTTTTGG + Intergenic
988327805 5:29793479-29793501 ATTGCCATGCAAAAAATTTTTGG - Intergenic
989285676 5:39696901-39696923 GCTGTCATGAGATAAATGTTTGG - Intergenic
991244371 5:64493526-64493548 TATGTCATAAGAAAAAGTTTTGG - Intergenic
991324285 5:65413392-65413414 TTTGTTATGAGAAATGTTTTTGG - Intronic
991414238 5:66376093-66376115 GTTTTCATGAAAAACATTTTAGG - Intergenic
992026112 5:72670298-72670320 CTTGTCCTGAGAAATAATATTGG + Intergenic
992168632 5:74079788-74079810 GTTATCATCAGAATAATTTTTGG - Intergenic
992238432 5:74737266-74737288 CTTGTCATGATTGAAAATTTAGG - Intronic
992260368 5:74964543-74964565 AATGGCATGAGAAAATTTTTGGG - Intergenic
993191005 5:84681015-84681037 GTTGTCAAAAGAAAAACTTTAGG + Intergenic
993434946 5:87881437-87881459 TTTCTCATGTGAAAATTTTTTGG - Intergenic
994585147 5:101698065-101698087 AATGTCATAAGAATAATTTTGGG - Intergenic
994642499 5:102427473-102427495 CTAATCATGATAAAAATATTAGG + Intronic
995293753 5:110493051-110493073 ATTGTCATTATAAAAAATTTAGG - Intronic
996954986 5:129172285-129172307 CTTATTATGAGAAAAACTTGGGG + Intergenic
998907308 5:146919843-146919865 CTTGTAATAAGAAAAATAGTTGG + Intronic
999741449 5:154556839-154556861 CTTTCCATGAGGAAAATTCTAGG - Intergenic
1000858310 5:166427301-166427323 CATGTCATGAGAAAAATATGAGG - Intergenic
1001501779 5:172242374-172242396 CTTGGTATGAAAAACATTTTGGG - Intronic
1002886975 6:1306124-1306146 GTTTTCAAGAGAAAAACTTTGGG - Intergenic
1003344609 6:5255725-5255747 CTTGGCATGACCAAACTTTTGGG + Intronic
1003914364 6:10771858-10771880 CTTTACTTCAGAAAAATTTTCGG + Intronic
1004299820 6:14447065-14447087 CTTATCAAAAGAAAAAATTTGGG - Intergenic
1005197450 6:23304810-23304832 TTTTTCATGTGAAAAATATTTGG + Intergenic
1005380237 6:25226138-25226160 CTTGACAGGAAAAAAATTATGGG + Intergenic
1005800284 6:29414776-29414798 CTGGTGTTGAGAAAGATTTTAGG - Intronic
1005970570 6:30757831-30757853 CTTCTCTTGAGAAAAGTATTTGG - Intergenic
1006095534 6:31653960-31653982 CTTTTTATTACAAAAATTTTCGG + Intronic
1007950137 6:45864757-45864779 CTTGTCATGGGGGAAATTCTTGG - Intergenic
1009828531 6:68898811-68898833 CTAATCATGAGTAAAATATTAGG + Intronic
1009976354 6:70675345-70675367 TTTTTCATTAAAAAAATTTTAGG + Intronic
1011089373 6:83578966-83578988 CTTTTCAGGAGAAAAAAATTGGG - Intronic
1011273891 6:85608804-85608826 CTGGTCCTGAAAAATATTTTAGG + Intronic
1011808432 6:91099726-91099748 TTTGTCATGAAAAACAGTTTTGG + Intergenic
1011927698 6:92668396-92668418 AATGTCATTAAAAAAATTTTTGG - Intergenic
1012616833 6:101287820-101287842 TGTGACATGAGCAAAATTTTGGG + Intergenic
1013215086 6:108019816-108019838 TTTGTTATGAGGAACATTTTTGG - Intergenic
1013553292 6:111231846-111231868 ATTCTCCTGAGGAAAATTTTGGG + Intergenic
1014011695 6:116483492-116483514 GATGTCATGAGGAAAATCTTAGG - Intergenic
1014192484 6:118513577-118513599 TTTCTCATGTCAAAAATTTTAGG - Intronic
1014880198 6:126714529-126714551 CTTGACATGGGAAGAATTTAGGG - Intergenic
1015606249 6:134957454-134957476 CTAATCATGAGAAAAATATCAGG - Intergenic
1015789194 6:136949595-136949617 CATGGCTTGAGTAAAATTTTAGG - Intergenic
1016257765 6:142129403-142129425 CTGGTCATTTTAAAAATTTTAGG + Intergenic
1016330294 6:142946657-142946679 CTTGTCATGCAAAAAAACTTGGG + Intergenic
1017941781 6:159059796-159059818 CTCTTCACTAGAAAAATTTTAGG - Intergenic
1019025423 6:168958350-168958372 CTTGTCATGAGTCTAATTTCTGG + Intergenic
1019090509 6:169527941-169527963 TTTGTCATATGACAAATTTTAGG - Intronic
1020725567 7:11809353-11809375 CTTGACAGGAGAGTAATTTTTGG + Intronic
1021523647 7:21562181-21562203 CTTGTCATGATCAACATTTTGGG + Intronic
1021922386 7:25499064-25499086 CTTGTCATTAAATAAGTTTTGGG - Intergenic
1022694920 7:32695271-32695293 CGTGTCATCAGAACAATTCTTGG + Intergenic
1023137851 7:37071022-37071044 ATTGTCCAGAGAAAACTTTTAGG + Intronic
1023269932 7:38451193-38451215 CTTGTCCTCAGAAAATGTTTTGG - Intronic
1024753499 7:52499690-52499712 GTTGTCATGAGCAATATGTTTGG + Intergenic
1027994156 7:85402719-85402741 CTTGACATGTGACATATTTTTGG - Intergenic
1028155820 7:87428045-87428067 CTTGCCATGAGCTAGATTTTTGG - Intronic
1029046458 7:97634495-97634517 CCTGTCATGAGAAAGGTGTTTGG + Intergenic
1030713326 7:112779766-112779788 CCTGTTATCTGAAAAATTTTAGG - Intronic
1031075239 7:117205973-117205995 CTTGTCAAGAGAAAAATAAATGG - Intronic
1031281696 7:119810945-119810967 TTTGTCATTCTAAAAATTTTAGG - Intergenic
1031643927 7:124200425-124200447 CTTGTCAACAGAAAAACCTTTGG + Intergenic
1032900345 7:136300240-136300262 CTAATTATGAGAAAAATATTTGG + Intergenic
1033164478 7:139027981-139028003 CTTGTCATAAATATAATTTTTGG - Intronic
1033466175 7:141591954-141591976 TTTGTCATGAGGCAAAATTTTGG - Intronic
1033938596 7:146621576-146621598 CTAATCATGAGAAAAACATTAGG - Intronic
1034623754 7:152476586-152476608 CATGTCACTAGAAAAATTTTTGG - Intergenic
1036001848 8:4613994-4614016 CATGTCCTAATAAAAATTTTAGG + Intronic
1038239397 8:25794613-25794635 CTTTTAATGGGAAAATTTTTTGG - Intergenic
1039277236 8:35946709-35946731 CTCTTTATGAGAAAAATTTACGG + Intergenic
1040420375 8:47234153-47234175 ATTTTGATGAGAAAAATGTTGGG + Intergenic
1043646561 8:82527857-82527879 CTTGTTATTGGAATAATTTTTGG - Intergenic
1044065787 8:87698751-87698773 CTTGTCATGTGGATAATTGTAGG - Intergenic
1046568953 8:115938059-115938081 CTTTTCATTACAAAATTTTTGGG - Intergenic
1047028327 8:120849081-120849103 ATTTTCATGAGAAATGTTTTTGG + Intergenic
1047707406 8:127513564-127513586 CTTATGTAGAGAAAAATTTTAGG - Intergenic
1048905500 8:139084307-139084329 CTTGTAATGAGACAAAGTTTTGG - Intergenic
1050676879 9:8065670-8065692 CTGGTCAAGAGAAAAAATATGGG + Intergenic
1052508684 9:29386020-29386042 CTTTTCATTACAAAAATTCTCGG - Intergenic
1052825643 9:33172246-33172268 GTTTTTATCAGAAAAATTTTGGG + Intergenic
1053616580 9:39772503-39772525 CTTGTATTGGGGAAAATTTTAGG - Intergenic
1053833296 9:42107631-42107653 CTTGTAATGAAGAAAATTTCTGG + Intronic
1053874748 9:42531812-42531834 CTTGTATTGGGGAAAATTTTAGG - Intergenic
1053897868 9:42762777-42762799 CTTGTATTGGGGAAAATTTTAGG + Intergenic
1054236938 9:62569886-62569908 CTTGTATTGGGGAAAATTTTAGG + Intergenic
1054267586 9:62934943-62934965 CTTGTATTGGGGAAAATTTTAGG + Intergenic
1054551075 9:66604397-66604419 CTTGTATTGGGGAAAATTTTAGG + Intergenic
1054597255 9:67079778-67079800 CTTGTAATGAAGAAAATTTCTGG - Intergenic
1055240050 9:74172823-74172845 CTTTTCGGGTGAAAAATTTTAGG + Intergenic
1055262033 9:74448344-74448366 ATTTTCATGAGAAAAACTGTAGG - Intergenic
1056282450 9:85055080-85055102 ATTCTCATGTGAATAATTTTGGG + Intergenic
1058180936 9:101798015-101798037 CATGTCATTAGAGAAAGTTTGGG - Intergenic
1058338710 9:103866627-103866649 CTTTCCATGAAACAAATTTTGGG - Intergenic
1058969945 9:110072056-110072078 CTGGTTCAGAGAAAAATTTTGGG - Intronic
1059108122 9:111529265-111529287 CTTCTTATGAAAAGAATTTTAGG - Intronic
1059793933 9:117670268-117670290 CTTATTAAGAGAAAAATATTTGG + Intergenic
1060126082 9:121048140-121048162 TTTGTAATTAGAAAAATTTAGGG + Intronic
1060338150 9:122746617-122746639 CTTTTCATAAGTAAAATTATTGG + Intergenic
1060373942 9:123101883-123101905 GTTGTCATGAGAAGAAATATAGG + Intronic
1187613178 X:20964883-20964905 CTTATAATAAGAAAAATTATGGG + Intergenic
1187739212 X:22337245-22337267 CTTGGCATGAAAAAAATTAAAGG - Intergenic
1188156304 X:26747583-26747605 CTTGGGAAGAGAAAAATTTCCGG - Intergenic
1188504358 X:30865338-30865360 CTTGTCTTGAGAGAACTTTTAGG + Intronic
1188600343 X:31955991-31956013 ATTGTCATGAGAATAAATTCTGG + Intronic
1188943929 X:36273920-36273942 TTTTTCATGAGAAAAATATCTGG + Intronic
1190017556 X:46840503-46840525 GATGTGATGAGAAATATTTTTGG + Intronic
1190243941 X:48678134-48678156 CTTTTAATAAGAAACATTTTTGG - Intronic
1191177402 X:57519170-57519192 CTTGGCATGGTAAAAATATTTGG - Intergenic
1192693317 X:73387591-73387613 CTTGTCAAAATAAACATTTTTGG + Intergenic
1194808548 X:98361565-98361587 ATGGACATGAGAAAACTTTTTGG - Intergenic
1195437924 X:104866620-104866642 CTTTTCATGGGAAAAGTTTGTGG + Intronic
1196588200 X:117455221-117455243 CTCTTAATGAGAAAAATGTTGGG + Intergenic
1196993086 X:121348999-121349021 CTTGTTAGGAGAAAAGGTTTTGG - Intergenic
1197516467 X:127436527-127436549 CTTGAAATGATAAAAATATTTGG + Intergenic
1197800541 X:130343130-130343152 GTTGTAAGGAGAAAAAGTTTTGG + Intronic
1197952923 X:131917391-131917413 CATGTCCTTAGAAAAATTTTCGG - Intergenic
1198814241 X:140570516-140570538 CTTGTCATGACAAAAAATTAGGG - Intergenic
1199859224 X:151785020-151785042 CTAATCATGAGAAAAATATCAGG - Intergenic
1199932083 X:152533352-152533374 AAAGTCATGAGAAAACTTTTTGG - Intergenic
1200663925 Y:5997017-5997039 TTTGTCAGCAGAAATATTTTAGG + Intergenic
1200944995 Y:8825937-8825959 CTTATCATGAGAACAATATAGGG + Intergenic
1201522877 Y:14896134-14896156 CTTGTCCTGCTGAAAATTTTGGG - Intergenic