ID: 1086631318 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:89023094-89023116 |
Sequence | GCACCCTCCTGTACTATTAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 64 | |||
Summary | {0: 2, 1: 0, 2: 0, 3: 4, 4: 58} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1086631315_1086631318 | 19 | Left | 1086631315 | 11:89023052-89023074 | CCAAACAGTGATGTATTATACTT | 0: 2 1: 0 2: 0 3: 19 4: 186 |
||
Right | 1086631318 | 11:89023094-89023116 | GCACCCTCCTGTACTATTATGGG | 0: 2 1: 0 2: 0 3: 4 4: 58 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1086631318 | Original CRISPR | GCACCCTCCTGTACTATTAT GGG | Intronic | ||