ID: 1086631318

View in Genome Browser
Species Human (GRCh38)
Location 11:89023094-89023116
Sequence GCACCCTCCTGTACTATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086631315_1086631318 19 Left 1086631315 11:89023052-89023074 CCAAACAGTGATGTATTATACTT 0: 2
1: 0
2: 0
3: 19
4: 186
Right 1086631318 11:89023094-89023116 GCACCCTCCTGTACTATTATGGG 0: 2
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086631318 Original CRISPR GCACCCTCCTGTACTATTAT GGG Intronic