ID: 1086634168

View in Genome Browser
Species Human (GRCh38)
Location 11:89062879-89062901
Sequence TGCCGCTCATGCCCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086634159_1086634168 26 Left 1086634159 11:89062830-89062852 CCTGGGTTTTCTTCCCTAAGTCG 0: 2
1: 0
2: 2
3: 7
4: 83
Right 1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 97
1086634162_1086634168 13 Left 1086634162 11:89062843-89062865 CCCTAAGTCGCTGTAGCCTGGGC 0: 1
1: 1
2: 0
3: 3
4: 57
Right 1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 97
1086634163_1086634168 12 Left 1086634163 11:89062844-89062866 CCTAAGTCGCTGTAGCCTGGGCT 0: 1
1: 1
2: 0
3: 6
4: 129
Right 1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 97
1086634158_1086634168 27 Left 1086634158 11:89062829-89062851 CCCTGGGTTTTCTTCCCTAAGTC 0: 2
1: 1
2: 2
3: 16
4: 205
Right 1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 97
1086634165_1086634168 -3 Left 1086634165 11:89062859-89062881 CCTGGGCTTCCTCCTTGGCATGC 0: 2
1: 0
2: 2
3: 40
4: 351
Right 1086634168 11:89062879-89062901 TGCCGCTCATGCCCCCGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086634168 Original CRISPR TGCCGCTCATGCCCCCGCCG TGG Intronic