ID: 1086641225

View in Genome Browser
Species Human (GRCh38)
Location 11:89158463-89158485
Sequence AGCAGTGATTCCTAAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086641224_1086641225 11 Left 1086641224 11:89158429-89158451 CCTGTCTTTAGGTAGAAATACAA No data
Right 1086641225 11:89158463-89158485 AGCAGTGATTCCTAAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086641225 Original CRISPR AGCAGTGATTCCTAAAAGTG TGG Intergenic
No off target data available for this crispr