ID: 1086641642

View in Genome Browser
Species Human (GRCh38)
Location 11:89165547-89165569
Sequence TTGGTTTTATAGTTATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086641634_1086641642 30 Left 1086641634 11:89165494-89165516 CCTATTTTATAATAAACTATCAT No data
Right 1086641642 11:89165547-89165569 TTGGTTTTATAGTTATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086641642 Original CRISPR TTGGTTTTATAGTTATTGGG AGG Intergenic
No off target data available for this crispr