ID: 1086642554

View in Genome Browser
Species Human (GRCh38)
Location 11:89177919-89177941
Sequence CAGTTCCTGCAGACCTTGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086642554 Original CRISPR CAGTTCCTGCAGACCTTGTG AGG Exonic
901339203 1:8480047-8480069 GAGTTTCTGCAGCCCTTGTGGGG - Intronic
903171350 1:21556325-21556347 CAGCTTCAGCAGACCTGGTGTGG + Intronic
903633184 1:24792839-24792861 CAGTTCATGAAGACCTGGTCAGG - Intronic
904074930 1:27833130-27833152 CAGTTACTGCATACCTTGCACGG - Intronic
906638644 1:47427510-47427532 CTGTTCCAGCAGACCTTGAGGGG + Intergenic
915490134 1:156246117-156246139 CACTTCCTGCCCACCTGGTGAGG - Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
920346029 1:205306246-205306268 AAGTTCCTGCAGACATTCTGTGG - Exonic
923018090 1:230142309-230142331 GAGTTCTCGCAGACCCTGTGTGG - Intronic
1063790873 10:9445493-9445515 CAGTTCCTGCAGACATTAAAAGG - Intergenic
1064107342 10:12511224-12511246 CAGTTACTGCTGACCTGGTAGGG + Intronic
1064948602 10:20820503-20820525 CAGGCCCTGCAGGTCTTGTGGGG - Intronic
1065282141 10:24150463-24150485 CTGCTCCTGCAGACCTTCTCTGG - Intronic
1068964966 10:62902647-62902669 CAGACCCTGAAGACCTTGTATGG - Intronic
1071355400 10:84788867-84788889 AAGTTCCTGAAGAGCCTGTGCGG - Intergenic
1071569038 10:86686443-86686465 CAGCCCCTGCAGACCCTGGGAGG + Intronic
1072269615 10:93763318-93763340 GAGATCCTGCAGAACTTGTTTGG - Intronic
1075316923 10:121460288-121460310 CTGTCCCTGCAGACACTGTGTGG + Intergenic
1075744627 10:124718191-124718213 CAGTTCTTACAGAGCTTGTTGGG - Intronic
1075900360 10:126038104-126038126 CAGAGCCTGCTGACCTAGTGAGG + Intronic
1076380802 10:130023494-130023516 GGGTTCCTGCAGACATAGTGGGG + Intergenic
1077111358 11:863613-863635 CGGTCCCTGCAGGCCTGGTGGGG - Intronic
1079109972 11:17599892-17599914 CAGTTCCTGCAGCCCCTGTCCGG + Intronic
1081120408 11:39258208-39258230 CAGATCCTGAAGAACTTTTGGGG + Intergenic
1081460664 11:43269797-43269819 CAGATCCTGCAGATCTTGACTGG + Intergenic
1084597768 11:70127337-70127359 CAGTTCCTGCAGAATTTCTCGGG - Intronic
1084999872 11:73022523-73022545 CAGATCCTGCAAACATTTTGTGG - Intronic
1085753109 11:79179187-79179209 CAGCTCTTGCAAACGTTGTGAGG - Intronic
1086195164 11:84129264-84129286 AAGTCCCTGCAGTCCTTCTGGGG + Intronic
1086642554 11:89177919-89177941 CAGTTCCTGCAGACCTTGTGAGG + Exonic
1087304186 11:96469784-96469806 CAGTTATTGGAGAGCTTGTGTGG + Intronic
1089223695 11:116897263-116897285 CAGCTGCTGAAGACCTGGTGTGG - Exonic
1092611205 12:10175027-10175049 TAGTTTCTACAGTCCTTGTGTGG + Intronic
1096737279 12:53665589-53665611 CAGTTCCTGTAGAGCCTTTGGGG - Intronic
1104035157 12:125092699-125092721 CAGTCCCTGCTGACCTGGGGAGG - Intronic
1105042803 12:132974304-132974326 CATTAGCTGCAAACCTTGTGGGG - Intergenic
1105251452 13:18702164-18702186 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1107203092 13:37746301-37746323 CAGTTACAGCGGACCTCGTGGGG + Exonic
1112225041 13:97531540-97531562 CATTTCCAGCAGACCTGGAGAGG - Intergenic
1113331963 13:109336217-109336239 CTGTTACTGCATACCTTGTCTGG + Intergenic
1113580315 13:111424095-111424117 CAGTACTTGCAGAGCTTTTGAGG + Intergenic
1115863957 14:37722174-37722196 CAGTTCCTGCATACCTCCTAAGG - Intronic
1116243009 14:42370776-42370798 CACTTCCTGCAGTTCTTCTGTGG + Intergenic
1117289793 14:54321282-54321304 CACTTCCTGAAGACCTTGCAGGG - Intergenic
1118778823 14:68992500-68992522 CTGCTCCTGCAGAGCTTGTCTGG + Intergenic
1122106409 14:99460321-99460343 CAGTTGCTTCAGAACTTGGGTGG - Intronic
1122889255 14:104724912-104724934 CACCACCTGCAGACCTTGCGGGG - Intronic
1124559023 15:30755153-30755175 AAGTTCCTGCAAGACTTGTGTGG + Intronic
1124604360 15:31159968-31159990 CAGTAGGTGCAGCCCTTGTGTGG - Intronic
1124672237 15:31650572-31650594 AAGTTCCTGCAAGACTTGTGTGG - Intronic
1128944785 15:71812810-71812832 CAGGCCCTGCAGACATTCTGTGG + Intronic
1131957856 15:97756947-97756969 AAGTTGCTGCAGAGCTTGGGCGG - Intergenic
1132031622 15:98443167-98443189 CAGGTTATGCAGACCTTTTGAGG - Intronic
1133369291 16:5235728-5235750 CAGCTCCTGCAGACCTAGGCGGG + Intergenic
1133976346 16:10602081-10602103 CAGTTCCCACAGGCCTTCTGGGG + Intergenic
1134537049 16:15034576-15034598 CAGGTCTTGCTGACCTTGGGAGG + Intronic
1135096283 16:19567439-19567461 CAGTTCCTACAGGCCTGGTGGGG - Intronic
1135883290 16:26279942-26279964 CAGTTCCTTCAGAGCATCTGTGG + Intergenic
1137665928 16:50248998-50249020 CAGATACTGCAGACTGTGTGTGG + Intronic
1137869146 16:51932897-51932919 CAGGGCCTGTGGACCTTGTGTGG - Intergenic
1138207529 16:55135663-55135685 CAGTTCCTGCAGACCTCAGGTGG - Intergenic
1142752465 17:1997287-1997309 CACTTCCTACAGACTTTGTCTGG + Intronic
1145751188 17:27356228-27356250 CAGTTCCTGCAGACCTTCCTGGG - Intergenic
1150354266 17:64469798-64469820 CAGATGCTGCAGTCTTTGTGTGG + Intergenic
1151655068 17:75491974-75491996 CTGCTCTTTCAGACCTTGTGAGG - Intronic
1153443987 18:5152087-5152109 CAATTCCTGTCAACCTTGTGGGG - Intronic
1153470093 18:5434465-5434487 CAGTTCCTGAAATCCTTGGGTGG + Intronic
1156681927 18:39600716-39600738 CATTTCCTCAAGAACTTGTGTGG - Intergenic
1157467856 18:47963135-47963157 CAGTTATTACAAACCTTGTGTGG + Intergenic
1158119763 18:54036169-54036191 CTTTTCCTTGAGACCTTGTGAGG - Intergenic
1159936171 18:74369323-74369345 CATTTCCTGGGGACCTTCTGAGG - Intergenic
1161547005 19:4887390-4887412 CAAGGCCTGCAGACCATGTGAGG + Intergenic
1164674064 19:30090266-30090288 CAGCTCCTGCAGACCTTTGAAGG + Intergenic
927592941 2:24372504-24372526 CAGTTCCTGAAGGCCTTATGTGG + Intergenic
928425596 2:31175238-31175260 CATTCCCTGCAGACCTTGGGTGG + Intronic
929430436 2:41881887-41881909 CAGTACCGACAGACCTTGTGGGG + Intergenic
931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG + Intergenic
935176740 2:100655478-100655500 CTGTCCCTGCAGAGCTAGTGAGG - Intergenic
937417871 2:121731353-121731375 CAGATCCTGCTGCCCTTGGGAGG - Intronic
937498620 2:122452262-122452284 CAGTTCCAGCAGTCTTTGGGTGG - Intergenic
937835427 2:126466392-126466414 AAGATCCTGGAGACCTTGGGAGG - Intergenic
937900366 2:127015367-127015389 CAGTTACTGCAGGCCTGATGCGG + Intergenic
937926384 2:127170847-127170869 CAGATCCTGCTGCCCTTGGGAGG + Intergenic
939328602 2:140728294-140728316 CAGTTCTTGCAGCCCTATTGTGG + Intronic
940405613 2:153298417-153298439 CAGTTCCTGAAGACATTTTTAGG + Intergenic
941110993 2:161418578-161418600 CACAACCTGCAGATCTTGTGGGG - Intronic
944166644 2:196729409-196729431 CACTTCCTGGATACCCTGTGAGG + Intronic
944533372 2:200685874-200685896 CATCTCCTGCAGCCCTAGTGTGG - Intergenic
947077973 2:226364919-226364941 CAGTTCCACTAGACCTTGTGAGG - Intergenic
1170033239 20:11964306-11964328 CAGTTACTGGAGGCTTTGTGAGG + Intergenic
1170161692 20:13319884-13319906 CAGGTCCTGCAGAGATTGTGAGG + Intergenic
1170572300 20:17639242-17639264 CAACTCCTGCAGACAGTGTGTGG + Intronic
1170775044 20:19367760-19367782 GAGATCCTCCAGACCTTGTCTGG - Intronic
1170912136 20:20583351-20583373 CAGAACCTGCAGAACTTGAGAGG + Intronic
1170972967 20:21133819-21133841 CAGTCCCTCCAGACCTTCAGAGG + Intronic
1172658052 20:36548975-36548997 CAGCTCTTGCAGACCTAGAGGGG - Intronic
1173307314 20:41862771-41862793 CAATTCCTGCTTACCTTATGAGG + Intergenic
1174186614 20:48710785-48710807 CTGTTCCTGCAGACGCAGTGTGG - Intronic
1176094443 20:63333486-63333508 CACTGCCTGCAGACCTAGGGAGG - Intronic
1176836979 21:13802050-13802072 CAGTTCCTGCAAATGGTGTGGGG + Intergenic
1179253467 21:39694862-39694884 CAGTGCCTTGTGACCTTGTGTGG + Intergenic
1179508868 21:41859108-41859130 CAGTCCCTGCAGGCCTGGTGAGG - Exonic
1179913528 21:44462308-44462330 CAGCTCCTGCAGCCCTTCCGGGG - Intergenic
1181670976 22:24425285-24425307 CCGTTCCTGGAGGCCTTGGGTGG + Intronic
1183712594 22:39514150-39514172 CGTTTCCTGCAGGCCTTGAGGGG + Exonic
1184776729 22:46627108-46627130 CGACCCCTGCAGACCTTGTGGGG + Intronic
1185085866 22:48740768-48740790 CGGTGCCTGCAGACCCTGCGAGG - Intronic
951621248 3:24604095-24604117 CAGTTCCCACAGACCTTGCTGGG + Intergenic
955338132 3:58103953-58103975 CAGCTCCTCCAGACCCTCTGTGG - Exonic
957870838 3:86089242-86089264 CAGTGCCTCCAGACTCTGTGTGG + Intergenic
960610978 3:119554526-119554548 CAGTGCCTGCAGGCCTAGAGGGG + Intronic
960723866 3:120650846-120650868 CAGGGCCTGCATACCTTGTGTGG - Exonic
965044877 3:163564261-163564283 CAGTTTCTGCTGATGTTGTGAGG - Intergenic
966273936 3:178141952-178141974 CAGATCATGTAGGCCTTGTGAGG - Intergenic
968236831 3:197036853-197036875 GAGTTCCTGCAGTCCTTGGGTGG - Intergenic
968750831 4:2388038-2388060 GGGTTCCTGCAGACCATGGGAGG - Intronic
973450637 4:50475376-50475398 CAAGGCCTGCAGACCATGTGAGG - Intergenic
974011481 4:56611659-56611681 TAGTTGCTGCAGAGGTTGTGAGG - Intergenic
974738514 4:65973374-65973396 TAGTACTTGCAGACCTTGAGAGG - Intergenic
977922919 4:102665576-102665598 CAGTTTATGCAGGCCTCGTGTGG - Intronic
980159630 4:129144849-129144871 CTGTTCCTGCACATCCTGTGAGG + Intergenic
985800838 5:2004658-2004680 CAGGTGCTGGAGCCCTTGTGTGG + Intergenic
986417520 5:7544183-7544205 CAGATCCTGCAGAGCTATTGAGG + Intronic
987497234 5:18662815-18662837 ACGTTCCTGCAGAACATGTGAGG - Intergenic
987706758 5:21468883-21468905 CAATTCCTCCAGACCTCGGGGGG - Intergenic
991412369 5:66357808-66357830 CATTTCCTGCGTACCTTGTAGGG - Intergenic
992184880 5:74234313-74234335 GAGTTCTTGCCGACCATGTGAGG - Intergenic
992297243 5:75337431-75337453 CAGCTCCTGCGGACCTGGAGGGG + Intronic
998121531 5:139582097-139582119 CAGTGCCTACAGTCCTTGGGAGG - Intronic
999624096 5:153501847-153501869 CAGTGCCTGGAGAACTGGTGAGG + Intronic
1002075832 5:176707869-176707891 TAGTTCCTGCAGATCTGGTGGGG - Intergenic
1006378822 6:33686110-33686132 CAGTTCCTGGACATCATGTGCGG + Exonic
1007104017 6:39270991-39271013 CAGCCCCTGCAGCCCTCGTGGGG - Intergenic
1007607250 6:43125914-43125936 CAGCTTCTGCAGACATGGTGGGG - Intronic
1008253134 6:49265106-49265128 CAGGTGCTGCAGGCCTAGTGGGG - Intergenic
1008370511 6:50725066-50725088 CAGTGTCTGCAGACAGTGTGGGG - Intronic
1010051119 6:71505360-71505382 CAGCTCCTGAGGTCCTTGTGTGG - Intergenic
1015059517 6:128946119-128946141 CAGTTCCTGTCGACCTAGAGAGG - Intronic
1016013650 6:139163171-139163193 CAGTGCCTGGAGACATTGAGTGG + Intronic
1019497732 7:1348214-1348236 CCCTCCCTGCAGACCTTGCGGGG + Intergenic
1021110310 7:16686416-16686438 CAGTTTCTCTAGACCTTGAGAGG - Intronic
1026421492 7:70241861-70241883 CAGTGCCTGCCGACTTTGAGAGG + Intronic
1029026346 7:97420910-97420932 CAGTTTCTACAGAGCTTGTGGGG - Intergenic
1037755844 8:21709683-21709705 CAGTACCTGCAGAGAGTGTGTGG - Intronic
1040276560 8:46016882-46016904 CCTTCCCTGCAGTCCTTGTGTGG - Intergenic
1045452199 8:102338555-102338577 CAGTTCCTGCAGGTCATGGGAGG - Intronic
1045502686 8:102755596-102755618 CAGTTAATGCAGAACCTGTGGGG - Intergenic
1048541024 8:135342218-135342240 CAGTTCCTGGAGCCCTTGGGAGG + Intergenic
1051552513 9:18345908-18345930 CAGGGCCTGCAGTCCTTGAGTGG - Intergenic
1052835048 9:33244215-33244237 CAGTTCAGCCAGACCTTGAGGGG + Intronic
1055639079 9:78305526-78305548 CAGGTCCTGGAGACATTGTTGGG - Intronic
1057475894 9:95401099-95401121 TATTTCCTGAATACCTTGTGGGG - Intergenic
1059947765 9:119429340-119429362 CCTTTCCTGCAGACCTTGACAGG + Intergenic
1062381599 9:136289587-136289609 CCCCTCCTGCAGCCCTTGTGGGG - Intronic
1186253674 X:7697201-7697223 CAGTTTCTGCTGACCTCTTGCGG + Intergenic
1186840613 X:13481294-13481316 CAGATCCTGGAGAGCTTGTGGGG + Intergenic
1187415543 X:19090172-19090194 CAGATTCTGCAGACCTTGCATGG + Intronic
1187968310 X:24634455-24634477 CATTTCCTGCAGGCCGTGCGCGG + Intronic
1191207355 X:57849159-57849181 GAGTTCCCCCAGACCCTGTGTGG + Intergenic
1194652232 X:96529907-96529929 CACGTGCTGCAGACGTTGTGGGG + Intergenic
1196537280 X:116862372-116862394 GAGTTCCTCCAGTCCTCGTGTGG + Intergenic
1196548925 X:116998088-116998110 CAGTCCCTGTAGACCATGTTAGG + Intergenic
1196699269 X:118649888-118649910 CAGTTTCTGCAAATCTGGTGGGG + Intronic
1201470492 Y:14328916-14328938 CAGTTTCTGCTGACCTCTTGTGG + Intergenic