ID: 1086643297

View in Genome Browser
Species Human (GRCh38)
Location 11:89186761-89186783
Sequence CAGTGTGACTATTTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 2, 2: 17, 3: 36, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086643290_1086643297 9 Left 1086643290 11:89186729-89186751 CCCAAAAATGTGTGTGTTGAATC 0: 1
1: 0
2: 10
3: 81
4: 463
Right 1086643297 11:89186761-89186783 CAGTGTGACTATTTGGAGGTAGG 0: 1
1: 2
2: 17
3: 36
4: 274
1086643291_1086643297 8 Left 1086643291 11:89186730-89186752 CCAAAAATGTGTGTGTTGAATCC 0: 1
1: 1
2: 39
3: 146
4: 799
Right 1086643297 11:89186761-89186783 CAGTGTGACTATTTGGAGGTAGG 0: 1
1: 2
2: 17
3: 36
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086643297 Original CRISPR CAGTGTGACTATTTGGAGGT AGG Intronic
900434230 1:2620555-2620577 TAATGTGACTATTTGGGGATAGG + Intronic
901156630 1:7144416-7144438 CAGTGTGACTGTGTGGAGATAGG - Intronic
905888495 1:41504799-41504821 CAGTGTGTCTATTTGGTGACGGG - Intergenic
905959508 1:42032155-42032177 GGGTGTGACTGTTTGGAGTTGGG - Intronic
906259315 1:44374511-44374533 ATGTGAGAGTATTTGGAGGTGGG + Intergenic
906876554 1:49545037-49545059 TAATGTGACTATTAGGAGGTGGG - Intronic
906885081 1:49636430-49636452 AAGTGAGGATATTTGGAGGTGGG - Intronic
908408234 1:63836101-63836123 CAGTGGGGCTATTGGGAGGAAGG - Intronic
908741078 1:67328249-67328271 TATTGTGACTATTTGGACTTTGG + Exonic
910166107 1:84329048-84329070 CAGTGAGGATATTAGGAGGTGGG + Intronic
910554287 1:88513555-88513577 GAATGTGACTATATGGAGATAGG - Intergenic
910639030 1:89440268-89440290 TAGTGTGCCTATTTGGATTTTGG - Intergenic
911360185 1:96866160-96866182 GAATGTGACTATTTGGAGATGGG - Intergenic
911504513 1:98732178-98732200 CAGTGGGCTTATTGGGAGGTAGG + Intronic
911981941 1:104579554-104579576 CAGTGGGCCTATTTGGATTTGGG - Intergenic
912256753 1:108067449-108067471 CAATGTGACTATTTGGAGATAGG - Intergenic
913565840 1:120071219-120071241 AGGTGTGACTAATTGGATGTGGG + Intergenic
913632291 1:120722334-120722356 AGGTGTGACTAATTGGATGTGGG - Intergenic
913995666 1:143650442-143650464 CAGGGAGACTTTTTGGTGGTTGG + Intergenic
914286430 1:146230588-146230610 AGGTGTGACTAATTGGATGTGGG + Intergenic
914547461 1:148681330-148681352 AGGTGTGACTAATTGGATGTGGG + Intergenic
914619054 1:149389028-149389050 AGGTGTGACTAATTGGATGTGGG - Intergenic
915083915 1:153371444-153371466 CAATGTGAGTATTAAGAGGTTGG - Intergenic
917033709 1:170722870-170722892 CGGTGTGAATATTTTTAGGTAGG + Intronic
917517504 1:175720121-175720143 CAGTGTGACAATTTGGAGATAGG + Intronic
920813767 1:209311592-209311614 CACTGGGACTTTTTGGAGGGTGG + Intergenic
922587217 1:226743153-226743175 GAATATGACTATTTGGAGGTAGG - Intergenic
923103406 1:230835747-230835769 GAATGTGACTACTTGGAGGCTGG + Intergenic
923986716 1:239389839-239389861 CAGTGTGACTATTAAGAAATTGG + Intronic
1064347871 10:14548900-14548922 AAGTGACAGTATTTGGAGGTGGG + Intronic
1064352295 10:14587114-14587136 CAGTGTGACTATTATCAGGCAGG - Intronic
1066566699 10:36728861-36728883 CAGTGTTGGGATTTGGAGGTGGG - Intergenic
1067822380 10:49541258-49541280 CAATGTGACTATTTGGAGACAGG - Intergenic
1067900859 10:50240149-50240171 CAGTGAGACTACGTGGTGGTGGG - Intronic
1071804603 10:89103311-89103333 AATTGTGACTATTTGGAGACAGG - Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1075407841 10:122206375-122206397 CAATGTGATTATTTGTAGGGAGG + Intronic
1075936058 10:126342242-126342264 AAGTGTGGCTATCTAGAGGTAGG + Intronic
1078160824 11:8838344-8838366 CAGTGTTACTAGTTTGTGGTGGG - Intronic
1078825501 11:14926238-14926260 GAATGTGACTATTTGGAACTAGG + Intronic
1079747446 11:24150973-24150995 CAATGTGACTATTTGGAGACAGG - Intergenic
1080730489 11:34946773-34946795 CAGATTCACTATTTGGAGCTAGG - Intronic
1083224360 11:61275309-61275331 CAGTCTGACTACTGGCAGGTGGG - Intronic
1083251899 11:61473847-61473869 CAGTCTGAGTAGTTAGAGGTGGG - Intronic
1084459338 11:69287441-69287463 CAGAGTGAGCATTTGGAGGTGGG - Intergenic
1084682773 11:70676639-70676661 TAATGTGAATATTTGGAGCTTGG + Intronic
1085173560 11:74467810-74467832 CAGTGTGGCTGTGTGGTGGTGGG + Intergenic
1086643297 11:89186761-89186783 CAGTGTGACTATTTGGAGGTAGG + Intronic
1086997251 11:93372295-93372317 CAGGCTGAATATTTGGAGGTGGG - Intronic
1087209393 11:95431131-95431153 CAGGGTGGGAATTTGGAGGTGGG + Intergenic
1088120136 11:106359452-106359474 GAATGTGACTATTAGGAAGTAGG + Intergenic
1088249215 11:107848441-107848463 ATGTGATACTATTTGGAGGTGGG + Intronic
1090768775 11:129900056-129900078 CAGTGTGAGTATTTTGGAGTAGG - Exonic
1093036251 12:14335024-14335046 TAGTGGGACTATTTGGATGTTGG + Intergenic
1094205920 12:27840334-27840356 TAGTGTGAATATTTGGTGTTTGG + Intergenic
1094289756 12:28833701-28833723 TAGTGTGGCCATTTGGAGGTAGG - Intergenic
1099365879 12:81765065-81765087 TAGTGTGCCTATTTGGATTTTGG + Intergenic
1099790869 12:87331764-87331786 AGATGTGACTATTAGGAGGTGGG - Intergenic
1099990725 12:89718146-89718168 CAAAGTGACTGTTTGGAGATAGG - Intergenic
1100064483 12:90625360-90625382 CTGTGTGCCTATTTGGATGATGG + Intergenic
1101796185 12:107976487-107976509 CAGTGTGACTCTTGGCAGGTAGG + Intergenic
1102430602 12:112879918-112879940 CAGTGTGCCTATTTGTAAATTGG + Intronic
1106869940 13:34008357-34008379 AAGGGAGATTATTTGGAGGTGGG - Intergenic
1108173004 13:47762656-47762678 CAGTGTGGCTCTTAGGAAGTAGG + Intergenic
1109271752 13:60263548-60263570 ATGTGTGAGTATTTGGAGATGGG + Intergenic
1109762798 13:66852101-66852123 CAGTGTGACTATTTGGAGATAGG - Intronic
1111066790 13:83104661-83104683 CAATGTGACTTTTTGGATGCTGG - Intergenic
1111082154 13:83324628-83324650 CACTGGGACTTTTTGGAGGGTGG + Intergenic
1112616961 13:101016013-101016035 CCGTGACCCTATTTGGAGGTAGG - Intergenic
1115159175 14:30373820-30373842 CAGTATGACTCTGTGGGGGTGGG - Intergenic
1117673367 14:58130726-58130748 CTGTGCTACTATTTGGAGATAGG - Intronic
1118818869 14:69331802-69331824 AAGTGTCAATATTTGGAGGGAGG - Intronic
1118880815 14:69824319-69824341 TAGTGGGACTATTTGGATTTTGG - Intergenic
1120518619 14:85499936-85499958 CAACGTGACTGTTTGGAGATAGG + Intergenic
1120593337 14:86402951-86402973 GAGTGTGGCTATTTGGAGAATGG + Intergenic
1120830189 14:88991135-88991157 CAATGTGACTGTTTGGACATAGG - Intergenic
1120943709 14:89974037-89974059 CAATGTGACTATTTGCAGAGAGG - Intronic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1122024655 14:98867012-98867034 GAATGTAACTATTTGGAGATAGG + Intergenic
1122042728 14:99000528-99000550 AAGTGTGACTTTTTGAAGGGAGG + Intergenic
1123066033 14:105619835-105619857 CAATGTGACTATTTGGAGATGGG + Intergenic
1123070175 14:105638888-105638910 CAATGTGACTATTTGGAGATGGG + Intergenic
1123074764 14:105662550-105662572 CAATGTGACTATTTGGAGATGGG + Intergenic
1123089413 14:105735675-105735697 CAATGTGACTATTTGGAGATGGG + Intergenic
1123095201 14:105763832-105763854 CAATGTGACTATTTGGAGATGGG + Intergenic
1125015716 15:34932543-34932565 CAGTGTGTCTATTGGAAGGTTGG - Intronic
1125297075 15:38214953-38214975 CAATGTGAATATTTGGAGACAGG + Intergenic
1126181825 15:45792856-45792878 CTTGGTGACTATTTGGATGTAGG + Intergenic
1127829740 15:62739795-62739817 TAGTCTTACTATTTGGAGGGAGG + Intronic
1127839846 15:62821626-62821648 CAGAGCGACTATTAGGAGGTTGG - Intronic
1127879366 15:63142915-63142937 CATTGTGAATATTAGGAGGCAGG + Intronic
1129086541 15:73099144-73099166 CATTGTGGGTATTTTGAGGTTGG + Intronic
1129316511 15:74748660-74748682 CAGGGTGACTCTTTGGGGATAGG - Intergenic
1131733513 15:95307078-95307100 CAATGTGATGGTTTGGAGGTAGG - Intergenic
1132302744 15:100786663-100786685 GAATGTGACTATTTGGAGACAGG + Intergenic
1132753048 16:1467655-1467677 CAGGGTGCCTGTTTGGACGTGGG - Intronic
1134393811 16:13843892-13843914 AAATGTGACTATTTGGAAATAGG - Intergenic
1135039437 16:19106718-19106740 CTGTGTGACTTTTTGGAGACAGG + Intergenic
1135865719 16:26099978-26100000 CTGTGTGGCTATCTGGAGGAAGG + Intronic
1137390939 16:48081117-48081139 CAGTGTGACAGTATAGAGGTAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137695430 16:50458697-50458719 CACTGTGCCTATCTGGATGTTGG + Intergenic
1139334519 16:66222451-66222473 GAATGTGACTATTTGGAGACAGG + Intergenic
1141722522 16:85764598-85764620 CAGTGGAACTATTTTGATGTAGG + Intergenic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1142780956 17:2180777-2180799 CAGAGGGACCATTTGGAAGTGGG + Intronic
1143990933 17:10960527-10960549 TAGTGTGATTTTTTGGAGGGGGG - Intergenic
1147834136 17:43317933-43317955 CAGTTAGATTAGTTGGAGGTGGG - Intergenic
1148581262 17:48745621-48745643 CACTGTGTCTTTTTGCAGGTGGG - Intergenic
1151099171 17:71536123-71536145 GAGTGTGAATATTAGGAGGTGGG - Intergenic
1152146806 17:78573272-78573294 GAATGTGACTATTTGGAGATAGG + Intronic
1152251582 17:79215309-79215331 CAGTGTGACTCTTTGGTTGACGG - Intronic
1153273595 18:3347310-3347332 CAGTGTGGCTACTTGGAGGCAGG - Intergenic
1153627216 18:7033091-7033113 CAATCTGTCTATTTGTAGGTTGG - Exonic
1153645686 18:7194242-7194264 CAGTGTGAATAGTTGGAGAAGGG - Intergenic
1153724957 18:7944956-7944978 CAGTGTCATTATTGAGAGGTGGG + Intronic
1156775202 18:40779281-40779303 AAGGATGACTTTTTGGAGGTGGG + Intergenic
1157975987 18:52327453-52327475 CAGTGTGGCCTTTTGGAGGGTGG - Intergenic
1158079142 18:53567822-53567844 CATTGATAGTATTTGGAGGTAGG - Intergenic
1158341702 18:56473230-56473252 GAATGTGACTGTTTGGAGATAGG - Intergenic
1158727545 18:59987272-59987294 GAGTGACAGTATTTGGAGGTGGG + Intergenic
1159820212 18:73131592-73131614 CAATGTGAGTATTCGAAGGTAGG - Intergenic
1159923914 18:74250032-74250054 CAGTGTGACTATTTGGAAACAGG + Intergenic
1165652743 19:37505697-37505719 GAGTGTGAATAGTAGGAGGTAGG + Intergenic
1165974154 19:39659637-39659659 CAATGTAAGTATTGGGAGGTTGG - Intronic
925264700 2:2558893-2558915 ACGTGACACTATTTGGAGGTGGG + Intergenic
926846372 2:17145537-17145559 AAGTGTGACTTTTGGGAGGTGGG + Intergenic
927218302 2:20682727-20682749 CAATGCAACTATTGGGAGGTGGG - Intergenic
928223383 2:29424291-29424313 CAGTTTGGCTATTTTTAGGTTGG - Intronic
930289849 2:49480326-49480348 CAGTGAGATTATTTGTATGTGGG + Intergenic
930412170 2:51038773-51038795 GAATGTGACTATTTGGAAATAGG + Intergenic
931771374 2:65500897-65500919 CGGTTTGACTGTTTGGAGGCTGG + Intergenic
931860915 2:66353539-66353561 CAGTGTGAATTCTTGGAGGATGG - Intergenic
932437163 2:71708951-71708973 CAATGTGACTATTTGGAGATAGG - Intergenic
933060487 2:77730988-77731010 CAGTGTGAGGATGTGGAAGTGGG - Intergenic
933648532 2:84831079-84831101 GAATGTGACCATTTGGAGTTAGG + Intronic
933652736 2:84862256-84862278 CAGGGGGACTCTTTGGAGGAGGG + Intronic
933726132 2:85428448-85428470 CCATGTGACTATTTAGAGATAGG + Intronic
934066523 2:88346862-88346884 CACTGTGACTATTTGGAGATAGG - Intergenic
936255510 2:110907322-110907344 CAATGTGACTATTTGGAGATAGG - Intronic
936768190 2:115879057-115879079 CAACGTGGCTATTTGGAGATAGG + Intergenic
936773622 2:115945278-115945300 CATTGATAGTATTTGGAGGTGGG - Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
940268907 2:151870286-151870308 CATTGTGAATATTTTGAGGGAGG + Intronic
940596913 2:155806166-155806188 CAATATGAGTATTTGGAGATAGG - Intergenic
940714941 2:157210975-157210997 CTGAGTTACTATTTGGAGCTAGG - Intergenic
940856395 2:158731634-158731656 CAGTGTGGATAATTGAAGGTTGG - Intergenic
941260696 2:163292902-163292924 CAGTGTCACTATTTAGAGACAGG + Intergenic
942650218 2:178158524-178158546 AAGTGATAGTATTTGGAGGTGGG - Intergenic
942682643 2:178494224-178494246 CAGTCTGATAATTTGGAGGTTGG + Intronic
942752575 2:179304387-179304409 GAATGTGACTAGTTGGAGATAGG + Intergenic
944917167 2:204372937-204372959 CTGTGTGTCTATTTAGAGTTTGG - Intergenic
946057395 2:216914022-216914044 GGGTGTGACTACTTGGAGGCAGG - Intergenic
946087809 2:217191954-217191976 CAGTGTGGCTATTTGCAATTTGG + Intergenic
947867824 2:233413574-233413596 CAGTGTGGCTATTTGGTGCCAGG - Intronic
1169054074 20:2605590-2605612 CAATGTGACTATTTGGAGATGGG - Intronic
1170611235 20:17915250-17915272 CAGTGGGACTCTTGGGAGGAAGG + Intergenic
1170613253 20:17930433-17930455 CAGAGTGACTTTTTGGATGGCGG - Intergenic
1170835311 20:19878859-19878881 CATTGAGACTATTTGAGGGTGGG - Intergenic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1172575391 20:36004188-36004210 GTGTGTGACTAGTAGGAGGTGGG + Intronic
1172899183 20:38321348-38321370 CAGTGTGTCTGGTTGGAGGGTGG - Intronic
1177366627 21:20148119-20148141 TTGTGTGACTATTGAGAGGTGGG + Intergenic
1178242958 21:30923575-30923597 CAATGTGACTGTTTGGAGATAGG - Intergenic
1179642712 21:42757874-42757896 CAGTGGGGCTATTTGGAGACGGG - Intronic
1179843333 21:44092009-44092031 CAGTGGTACTAGTTGCAGGTCGG - Exonic
1180016891 21:45093061-45093083 TTGTGTGAATATTTGGGGGTGGG - Intronic
1182052232 22:27322249-27322271 CAATGTGACTGTTTGGATATAGG - Intergenic
1183370894 22:37431611-37431633 CAGTGGGATCATTTGGATGTGGG - Intergenic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950392719 3:12709252-12709274 CAGTTTGACTGTTTGGATGTAGG + Intergenic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
951287261 3:20828445-20828467 CAGTGTGAATACTTTGAGTTCGG - Intergenic
953190779 3:40685580-40685602 GAATGTGACTATTTGGAGATAGG - Intergenic
954566730 3:51606311-51606333 CAGAGAGACTATGTGGAAGTTGG + Intronic
954769381 3:52952450-52952472 CAGTATGACTGTTTGGATATAGG + Intronic
954965981 3:54611398-54611420 CAGTCTGAGTCTTTGGAAGTGGG - Intronic
957510259 3:81179186-81179208 CAATGTGATGATTCGGAGGTGGG + Intergenic
957586191 3:82135537-82135559 GAGTGTGACCATGTGGAGATAGG - Intergenic
957981514 3:87517270-87517292 GATTGTGACTATTTGGAAATGGG - Intergenic
959341441 3:105136450-105136472 CAGTGTGCCTTTATGGAAGTGGG + Intergenic
959495718 3:107049019-107049041 CAATGTGACTATTTGGAGATAGG - Intergenic
959496555 3:107058676-107058698 CAGTGTTACCATTTGGTGGCTGG - Intergenic
959527507 3:107394160-107394182 GAGTGTTACTATTTGGGGATTGG - Intergenic
960680245 3:120240013-120240035 GAGTGTGACTACAAGGAGGTGGG + Intronic
962850317 3:139303560-139303582 CTGTGATAGTATTTGGAGGTAGG - Intronic
963262479 3:143206735-143206757 CAGTGTGAGTTTTTGTAGGAAGG + Intergenic
966453311 3:180086594-180086616 CAATGTGAGTATTAGGAGATGGG + Intergenic
968048610 3:195638226-195638248 CAGCGTTATTGTTTGGAGGTGGG + Intergenic
968632626 4:1659907-1659929 CGGGATGAATATTTGGAGGTGGG - Intronic
969850019 4:9948649-9948671 GAGTGGGATAATTTGGAGGTGGG - Intronic
970287852 4:14538257-14538279 CAATGTGACTATTTGGAGACAGG + Intergenic
970634603 4:17993914-17993936 CAGCGTCATTATTTTGAGGTGGG + Intronic
970748545 4:19329851-19329873 AAGTGTGATTATATGGAGGATGG + Intergenic
971575504 4:28267979-28268001 CAATATGACTATTTGGAGAGAGG + Intergenic
971599191 4:28570363-28570385 TAGTGTGATCATTTGGAGATAGG - Intergenic
972095459 4:35342360-35342382 CAGTGGGCCTATTTGGATTTTGG + Intergenic
972923760 4:43976836-43976858 CAGTGTGACTATTGAGAGATAGG - Intergenic
973217213 4:47682789-47682811 CTGTGTGACTAGATAGAGGTGGG - Intronic
974361767 4:60890073-60890095 GAATGTGACTGTTTGGAGATAGG + Intergenic
974937053 4:68420893-68420915 CAGTTAGGCTACTTGGAGGTCGG - Intergenic
975233362 4:71961015-71961037 CAATGTGATGATTAGGAGGTGGG + Intergenic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
976282940 4:83342968-83342990 CATTGTAACTATTAGGAGGTGGG + Intergenic
976817306 4:89163882-89163904 CATTGTGGCTATTTGGGGGCTGG + Intergenic
977242823 4:94593660-94593682 CAATGTGACTATTTGGAGATAGG - Intronic
977814702 4:101401423-101401445 CAGTGTGACTGCTTGGAGACAGG + Intergenic
978358276 4:107901146-107901168 CACTATGACTATTTGTAGCTTGG - Intronic
978966800 4:114750623-114750645 TAGTGTGCCTATTTGGATTTTGG + Intergenic
979111801 4:116767362-116767384 AACTGTGAGTAGTTGGAGGTAGG - Intergenic
979889464 4:126072945-126072967 AAATGTGACTATTTAGAGATTGG + Intergenic
980969173 4:139553385-139553407 CAGTGTAACTCTGTAGAGGTTGG - Intronic
981042843 4:140238824-140238846 CAGTGGGACTATTAGGAGCCTGG - Intergenic
981331771 4:143517632-143517654 CAGTGTCATTATATGGAGGAAGG + Intronic
982303260 4:153901532-153901554 CAGTGTGCCTAGGTGGAGGTGGG + Intergenic
986549503 5:8936672-8936694 TAGTGTGGTCATTTGGAGGTAGG - Intergenic
986702637 5:10426281-10426303 CAGTTTGACTATTTTTGGGTTGG + Intronic
986821319 5:11469881-11469903 CAGTGAGACTAAATGGAGGCAGG - Intronic
987095593 5:14546470-14546492 CAATGGGACTATGTGGAGATGGG + Intergenic
987484192 5:18503062-18503084 CCATGTGGCTATTTGGAGGAAGG - Intergenic
987653146 5:20770843-20770865 CAGTGATGATATTTGGAGGTGGG - Intergenic
988742428 5:34090641-34090663 CAGTGATGATATTTGGAGGTGGG + Intronic
989473864 5:41851919-41851941 CAGTGTGACTGTATTGAGATAGG + Intronic
990293182 5:54375661-54375683 GAGTATGAATATCTGGAGGTGGG - Intergenic
990362677 5:55037101-55037123 CAGTGTGACTGTTTGGAGGTGGG + Intergenic
991027932 5:62051395-62051417 TAGTGTGGTCATTTGGAGGTAGG + Intergenic
991694962 5:69262219-69262241 CCGAGTTACTATTTGGAGCTAGG + Exonic
991714435 5:69438117-69438139 CAGTGGGCCTGTTTGGAGGCAGG + Intronic
992210159 5:74471379-74471401 CAATGTGACTATTTGTACATAGG + Intergenic
992424836 5:76646277-76646299 CAGTGTGACAATTCTGAGATGGG - Intronic
993319780 5:86458257-86458279 TAGTGTGCCTATTTGGATTTTGG + Intergenic
993416773 5:87643169-87643191 CAGTGTCACTATTGAGAGATGGG + Intergenic
994855475 5:105113901-105113923 TAGTGGGACTATTTGGATTTTGG - Intergenic
995463104 5:112422755-112422777 CAATGTGACTGTTTAGAGATAGG - Intergenic
995630323 5:114125902-114125924 CTTTGTGACTGTTTGGAGATAGG - Intergenic
996107514 5:119521850-119521872 CAGTTTGTTTATTTGGAGGGGGG + Intronic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
999080188 5:148836222-148836244 CAGTGATGCTATTGGGAGGTTGG - Intergenic
999969513 5:156845157-156845179 AAGTGTTAGTATTTGGAGATGGG + Intergenic
1000982966 5:167836352-167836374 CAGTGTGAGTTCCTGGAGGTAGG - Intronic
1001059808 5:168478709-168478731 GAATGTGACTATTTGGAAATAGG - Intergenic
1001089665 5:168727899-168727921 CAGTGTGGCTATGGGGAGCTTGG + Intronic
1002834295 6:852918-852940 GAGTATGACTATTTGGAGATAGG + Intergenic
1003617488 6:7668749-7668771 GAATGTGACTGTTTGGAGATAGG + Intergenic
1005399707 6:25418993-25419015 CATTGTTTCTATTTGGAGTTGGG + Intronic
1007711298 6:43825959-43825981 CAGTGAGACTATCTGGAGACAGG + Intergenic
1008431956 6:51428853-51428875 AAATGTGATTATTTGTAGGTTGG - Intergenic
1010380860 6:75223373-75223395 GGATGTGACTATTTGGAGATAGG - Intergenic
1011885650 6:92091822-92091844 GAATGTGACTATTTGAAGATAGG + Intergenic
1012318585 6:97813808-97813830 CTGTGTGCCTTTTAGGAGGTTGG + Intergenic
1014317427 6:119884794-119884816 CAATGTGACTGTATGGAGATAGG + Intergenic
1016017176 6:139198479-139198501 CATTGTAACAATCTGGAGGTAGG - Intergenic
1017557533 6:155587928-155587950 CCGTGTGACTGTTTGGAGATAGG + Intergenic
1017707150 6:157133715-157133737 CAGTGTGACTCTTCGGAGACAGG + Intronic
1018290190 6:162284896-162284918 AAATGTGACTGTTTGGAGATAGG + Intronic
1018576995 6:165269181-165269203 CAGTGTGTTTGTTTGGTGGTGGG + Intergenic
1019580716 7:1760707-1760729 CGGTGTGACTTTTTGGTGGGTGG - Intergenic
1021361788 7:19723656-19723678 CAATGTGACTATTTGCAAATGGG + Intronic
1024421437 7:49171617-49171639 CAGTGTGACTATCTGGATTTTGG - Intergenic
1024814617 7:53254403-53254425 GCGTGTGACTACCTGGAGGTAGG + Intergenic
1024819231 7:53307518-53307540 CATTGTTACTGTTTTGAGGTAGG + Intergenic
1024866051 7:53906021-53906043 CAGTGGGCCTATTTGGATTTTGG + Intergenic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1027965281 7:84997586-84997608 CAGTTTGACTACTTTGAGATAGG + Exonic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1029980621 7:104875329-104875351 GGGTGTGAGGATTTGGAGGTGGG - Intronic
1030653259 7:112138716-112138738 CAATGTGACAGTTTGGAGATGGG + Intronic
1030926734 7:115466231-115466253 CAGTGACAATATTTGGAGATAGG - Intergenic
1032172747 7:129599489-129599511 GAATGTGACTATTTGGAGACAGG + Intergenic
1032604698 7:133337332-133337354 CATTGGGACTATTTGGAGTCTGG + Intronic
1032648741 7:133854725-133854747 AAGAGGGACTATTTGAAGGTAGG - Intronic
1032809370 7:135395341-135395363 CATTTTTACTTTTTGGAGGTGGG - Intronic
1033521661 7:142167080-142167102 AAATGTGACTATTTGGAAGTAGG - Intronic
1035253354 7:157611523-157611545 CAGTGTGTCTTTTTGGGGGAGGG - Intronic
1035690749 8:1557875-1557897 GAATGTGATTATTTGGAGATGGG - Intronic
1036114440 8:5943520-5943542 GAATGTGACAATTTGGAGATGGG - Intergenic
1036511118 8:9401301-9401323 CAATATGACTGTTTGGAGATAGG - Intergenic
1036941350 8:13055825-13055847 CAGTGTGGCTATTTGGGGGCAGG - Intergenic
1037157615 8:15723991-15724013 CAGTGTGACTGTTTGGACGTGGG + Intronic
1038340978 8:26684671-26684693 GAATGTGACTATTTGGAGATAGG + Intergenic
1038559522 8:28559852-28559874 CAGAGTGAGTATTGGGAAGTGGG - Intronic
1040323501 8:46329868-46329890 CAGGGTGACTGTTTGGGGGAGGG - Intergenic
1040770965 8:50974837-50974859 GAGTGTGTATATTTAGAGGTAGG + Intergenic
1041790784 8:61694099-61694121 CAGTTTGAGTATGAGGAGGTAGG - Intronic
1043125108 8:76383601-76383623 CAATGTGGGTATTTGGAGATTGG - Intergenic
1043603167 8:81965927-81965949 CTGTGTAACTATTTGGAAGAAGG - Intergenic
1044919702 8:97155824-97155846 CAATGTGACTGTGTGCAGGTAGG + Intergenic
1046867426 8:119166115-119166137 CAGTGTCACTTTTTGTATGTAGG - Intronic
1047299555 8:123601415-123601437 CAGTGTATGTATTTGTAGGTGGG + Intergenic
1047492327 8:125385280-125385302 GAGTTTGAATATTTGGAGTTTGG - Intergenic
1048036079 8:130678441-130678463 CAATGTGACTCTTTGGAGATAGG + Intergenic
1048464032 8:134648668-134648690 CAGTGAGACTATTTGGTCCTGGG - Intronic
1050369501 9:4906324-4906346 GAATGTGATTATTTGGAGATAGG + Intergenic
1050708977 9:8438102-8438124 CACTGTGGCTCTTTGGAGGAAGG + Intronic
1052048961 9:23824225-23824247 AACTGTGACAAATTGGAGGTTGG - Intronic
1052135287 9:24901753-24901775 CAGAGAGGCTATTTGGAGGCTGG + Intergenic
1052409542 9:28105603-28105625 CTGTGTGACTACTGGGAGATGGG + Intronic
1053153500 9:35757354-35757376 CAGTCTGACTGTATGGAGGCAGG + Exonic
1053478135 9:38396578-38396600 CAGGGTGACTCTCTTGAGGTTGG - Exonic
1055618619 9:78099651-78099673 CAGTGTGACTGTTTGGAAATAGG + Intergenic
1055684968 9:78762923-78762945 CAATGTGACTATTTGGAGATAGG + Intergenic
1055742708 9:79407469-79407491 CAATGTGACTATTCAGAGATAGG - Intergenic
1057865686 9:98678687-98678709 CACTCTGAAAATTTGGAGGTGGG - Intronic
1058439397 9:104993233-104993255 CAGTATGATGATTAGGAGGTGGG - Intergenic
1059152253 9:111959610-111959632 CAGTGTGAGAATTTGGTTGTGGG - Intergenic
1059255983 9:112931213-112931235 CAATGTTAATATTTGGATGTTGG + Intergenic
1059358462 9:113719615-113719637 CAGTGTGACTATTTGGATATAGG + Intergenic
1059602206 9:115791212-115791234 CAGTGTGGCTATTCTGATGTGGG - Intergenic
1061372135 9:130203407-130203429 CAGTGTGAATATTTGAATGAGGG + Intronic
1062220627 9:135413327-135413349 CTGTGTGGCTATTTGGAGACAGG - Intergenic
1186094610 X:6086066-6086088 AAGTGTTGCTATTTGGATGTAGG + Intronic
1187449667 X:19385496-19385518 GGGTGTGACTATCAGGAGGTAGG + Intronic
1188634464 X:32411611-32411633 TGATTTGACTATTTGGAGGTAGG - Intronic
1188794588 X:34446112-34446134 CACTGTGACATTTTGGAGGGTGG + Intergenic
1191025926 X:55913348-55913370 GAATGTGACTATTTGGAGACAGG + Intergenic
1191716162 X:64195153-64195175 TTGTGTGTGTATTTGGAGGTGGG - Intronic
1192312822 X:70030575-70030597 CTGGGTGATTATTTGGAGGCTGG - Intronic
1193367162 X:80648915-80648937 GTGTGTGTCTATTTTGAGGTGGG - Intergenic
1193614255 X:83668404-83668426 TAGTGTGGTCATTTGGAGGTGGG - Intergenic
1193957077 X:87876682-87876704 CAGTGGGCCTATTTGGATTTTGG + Intergenic
1194799061 X:98248905-98248927 CAATGTGACTAATTGGCTGTGGG + Intergenic
1194870681 X:99127525-99127547 TAGTGTGCCTATTTGGATTTTGG + Intergenic
1195033848 X:100952821-100952843 GAGTGTGACTATACAGAGGTAGG + Intergenic
1195805680 X:108762889-108762911 CAGTGCAACTGTTGGGAGGTTGG - Intergenic
1195995647 X:110729173-110729195 CATTGTTACTTTTTGGAGGTGGG - Intronic
1197084248 X:122453822-122453844 TAGTGTGCCTATTTGGATTTTGG - Intergenic
1197386862 X:125813016-125813038 TAGTGTGCCTATTTGGATTTTGG - Intergenic
1198630126 X:138628003-138628025 CACTGTTACTCTTTAGAGGTTGG - Intergenic
1200340541 X:155390964-155390986 CAGTGGGCCTATTTGGATTTTGG - Intergenic
1200756107 Y:6991492-6991514 CTGTGAGCTTATTTGGAGGTGGG + Intronic