ID: 1086644507

View in Genome Browser
Species Human (GRCh38)
Location 11:89203326-89203348
Sequence GTCCCCAGCTTTACTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086644507_1086644508 5 Left 1086644507 11:89203326-89203348 CCTGCTAAAGTAAAGCTGGGGAC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1086644508 11:89203354-89203376 TAAACTCCCAACCCTGCCTCTGG 0: 1
1: 0
2: 2
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086644507 Original CRISPR GTCCCCAGCTTTACTTTAGC AGG (reversed) Intronic
900422940 1:2563425-2563447 GTCCCCAGCTCTACCCCAGCAGG - Exonic
902767560 1:18627555-18627577 GACCCCAGCTTGAGTTTAGCTGG - Intergenic
903741726 1:25562390-25562412 GTCCCCATCTTTACTATCTCTGG - Intronic
912946248 1:114087339-114087361 CTCCCCAGCTTTCCCTTGGCTGG - Intergenic
915635650 1:157184729-157184751 GTCCCCAGCTTGGCCTCAGCTGG + Intergenic
918545649 1:185680727-185680749 GGCCCTGGCTTTACTTTACCTGG + Intergenic
918828629 1:189361592-189361614 GTTCTAAGCTTTACGTTAGCAGG + Intergenic
921994330 1:221401070-221401092 GTCCCAGGCTTTTCTTTAGTGGG - Intergenic
923152493 1:231246159-231246181 CTCCCCAGCTTTGCGTTTGCTGG + Intronic
1068386467 10:56334569-56334591 GTCCTCAGCTTTTCTTTGTCTGG + Intergenic
1070358035 10:75659376-75659398 TTCCCCAGCTTTATTTGAGGTGG + Intronic
1075632364 10:124008464-124008486 GTCCCCACCTTCTCTATAGCCGG - Exonic
1076427999 10:130381036-130381058 GTTCCCAGCCTCACTTCAGCTGG - Intergenic
1080127085 11:28748130-28748152 CTCCTCAGTTTTCCTTTAGCTGG + Intergenic
1086644507 11:89203326-89203348 GTCCCCAGCTTTACTTTAGCAGG - Intronic
1092977174 12:13756521-13756543 TCCCCCAGTTTTTCTTTAGCTGG - Intronic
1099495560 12:83341981-83342003 GTCCCCAGCTTTTCTTTACTGGG - Intergenic
1099614870 12:84921289-84921311 GCCCCCAACTTTACTTTATAGGG + Intergenic
1104600376 12:130149444-130149466 GTGCCCAACTTTACTTTTGGGGG + Intergenic
1107667519 13:42706901-42706923 TTCCCCAGCTTAATTTGAGCTGG + Intergenic
1108423259 13:50271970-50271992 TTTCCCAGCTTAAATTTAGCAGG + Intronic
1119476434 14:74932788-74932810 GTCCCTAGAGTCACTTTAGCAGG + Intergenic
1121956650 14:98219550-98219572 TTCCCCAGGTTCACTTTGGCAGG + Intergenic
1123118457 14:105905366-105905388 GTCCCAAGCTTTACCTGACCTGG - Intergenic
1126096634 15:45095077-45095099 GTCCCCAGATCTACTTCATCTGG - Exonic
1126108762 15:45163524-45163546 GTCCCCAGATCTACTTCATCTGG + Exonic
1128914556 15:71548006-71548028 GTACCCAGATGTACCTTAGCAGG + Intronic
1133548497 16:6831074-6831096 CTATCCAGCTTTACTTTAGATGG - Intronic
1134915355 16:18065115-18065137 GACCCGGGCTTTTCTTTAGCGGG - Intergenic
1137978232 16:53048793-53048815 GTCCCCAGCTTCCCTTCTGCAGG - Intergenic
1140785412 16:78336613-78336635 GTCCCCATCTGTACTTTGGGAGG + Intronic
1143794441 17:9325435-9325457 GGCCCTAGCTTTACCTTAACAGG - Intronic
1146535162 17:33643908-33643930 GTACCCAACATGACTTTAGCTGG + Intronic
1146764964 17:35512081-35512103 GTTCCCATCTTAACTTTACCGGG - Intronic
1148592359 17:48825911-48825933 GGTCTCAGCTTTATTTTAGCCGG + Intergenic
1149453551 17:56768889-56768911 ATCCCAAGCTTTACTTTCTCAGG - Intergenic
1151880172 17:76889954-76889976 GTCCCCAGCTTTTCTGTTGAAGG + Intronic
1152836190 17:82533780-82533802 GTGCCCAGCTGTAGGTTAGCCGG + Intronic
1153862709 18:9230128-9230150 GTCCCCAGCTTTTCTTTGTTAGG + Intronic
1153960447 18:10135701-10135723 CCCCCCAGCTTTCCTTTAGCTGG - Intergenic
1154379858 18:13839098-13839120 GTCCCCAGCATTCCTTTGGTTGG - Intergenic
1157600274 18:48889345-48889367 GCCCCCAGCTTTTCTTTACAGGG - Intergenic
1158448534 18:57542582-57542604 GACCCCTGCTTTAATTAAGCAGG + Intergenic
1159091714 18:63856658-63856680 GTCCCGGGCTTTACTTTACTGGG + Intergenic
1159322760 18:66875351-66875373 GGCCCCATCTTTACTTTTACGGG + Intergenic
1164491238 19:28716334-28716356 GTCCCGAGCTTTTCTTTACTTGG - Intergenic
1165646675 19:37444950-37444972 TTCCCCAGCTCTACTTCTGCAGG - Exonic
1167423727 19:49418654-49418676 GTCCTCAGCTTTACTCCAGCTGG - Intergenic
929288569 2:40163876-40163898 GTCCCCTCTTTTCCTTTAGCTGG - Intronic
933867313 2:86533050-86533072 GTCCACAGCTTTTCTTTGTCAGG + Intronic
936871768 2:117141730-117141752 GTTCCCAGCTTAGCTTTACCTGG - Intergenic
937061200 2:118981701-118981723 GTCCCCAGCTTCACTCTGCCAGG - Intronic
939256851 2:139755133-139755155 GTCCCAAGCTTTACTTTACTTGG + Intergenic
942751669 2:179294806-179294828 GTGCACAGCTTTAGTTTAGCAGG - Intergenic
945258513 2:207822889-207822911 GGCCCCAGCTGTCCTCTAGCTGG + Intergenic
945334477 2:208575983-208576005 GTCCTGAGCTTTACTTTACTGGG - Intronic
945499697 2:210556441-210556463 AACCCCAGCATTATTTTAGCAGG + Intronic
946639290 2:221766173-221766195 GTCACCAGCTGAACTTCAGCAGG - Intergenic
949019632 2:241734181-241734203 GTCCCCAGCCTTAGCTTAGGGGG - Intergenic
1169110678 20:3031369-3031391 GTCCCCAGCTTTTCTTCTACTGG + Intronic
1178595635 21:33950167-33950189 GGCCCCAGCTTTCCTTAAGGAGG - Intergenic
1181762942 22:25070306-25070328 GTTTCCAGCTTTCCTCTAGCGGG - Intronic
1182378799 22:29869750-29869772 GTCCCCAGTTATTTTTTAGCTGG + Intergenic
953443939 3:42946370-42946392 GTCCTCAGTTTTACTTTTTCAGG + Intronic
956804775 3:72798538-72798560 TTCCCCAGCTTTCCTTTAAAGGG + Intronic
960491093 3:118317376-118317398 GTCCCCAGCTTTTTTTTTACTGG - Intergenic
962466524 3:135664893-135664915 GTCCCTGGCTTTTCTTTAGTGGG - Intergenic
962866881 3:139454433-139454455 CTCCCCAGCTGGTCTTTAGCAGG + Intronic
965771283 3:172183984-172184006 ATCCCCAGAATTACTTTAGGAGG + Intronic
966383814 3:179372395-179372417 GTTCCCAGATTTATTTTATCAGG - Intronic
968965185 4:3766057-3766079 GTCTCCAACTTTACTTTCCCGGG - Intergenic
971990944 4:33892836-33892858 GTTCCCAGCTTCACTTCAGTTGG - Intergenic
976709936 4:88059191-88059213 TTCCCTAGCTGTACTTTAACAGG + Intronic
989434504 5:41395820-41395842 GTCCCAAGCTTTTCTTTAGTGGG - Intronic
993206766 5:84891538-84891560 GTCCCAGGCTTTTCTTTAGTGGG + Intergenic
1001456174 5:171861977-171861999 GTCCCCTGCTATAATTTAGTAGG + Exonic
1001509925 5:172313023-172313045 GGCCCCAGCTATAGTTTAGACGG + Intergenic
1004681224 6:17896662-17896684 GTTCCCAGCCTTATTTTTGCTGG - Intronic
1011663805 6:89616487-89616509 GCCCCCAGCTTTTCATTACCTGG - Intronic
1012050214 6:94332312-94332334 GTCCCAGGCTTTTCTTTAGTGGG - Intergenic
1017568760 6:155718232-155718254 GTCCCGAGCTTTTCTTTGACAGG + Intergenic
1018604419 6:165582054-165582076 GTCCCCGCTTTTACTTAAGCAGG + Intronic
1019435639 7:1020886-1020908 GTCCCCAGCTCTGCTGTATCAGG - Intronic
1020664211 7:11019368-11019390 GTCCCAGGCTTTTCTTTACCGGG + Intronic
1024660893 7:51493306-51493328 GTCCCAGGCTTTTCTTTAGAGGG + Intergenic
1027515981 7:79142408-79142430 CTCCACAGCTTTTCTTTAACAGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029796793 7:102904120-102904142 GTCCCAAGCTTTTCTTTACTGGG + Intronic
1030162558 7:106524058-106524080 GTCCTCAACTTTACTTTAACAGG + Intergenic
1030561880 7:111097282-111097304 GTCCCAAGCTTCACGTTAGGGGG - Intronic
1033833405 7:145280416-145280438 GTCCCAAGCTTTTCTTTACTGGG + Intergenic
1040973982 8:53169804-53169826 GTCCCCAGCCTAACTTCAGGGGG - Intergenic
1045827006 8:106409673-106409695 CTCACTAGCTTTATTTTAGCGGG + Intronic
1047414301 8:124651533-124651555 GTCCCCAGCCTTTATTTAGAGGG - Intronic
1055492104 9:76815837-76815859 GTCTCCAACTTGAGTTTAGCTGG + Intronic
1056005420 9:82264685-82264707 GTCCATTGCTTTAGTTTAGCAGG + Intergenic
1058232798 9:102450671-102450693 GTCCCTGGCTTTACTTTACTGGG - Intergenic
1060294225 9:122332365-122332387 TTCCCCTGCTTTCCTTTGGCAGG - Intergenic
1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG + Intergenic
1061107715 9:128544754-128544776 GTCATCAGATTTGCTTTAGCAGG - Intergenic
1188625401 X:32278324-32278346 GTCCCAAGCTTTTCTTTACTGGG - Intronic
1190404265 X:50070672-50070694 GTCCCCAGTTTGAATTTAACTGG - Intronic
1192394454 X:70764839-70764861 GTCCCCAGCTTTTCTTTACTGGG - Intronic
1194157592 X:90411814-90411836 GTCCCAGGCTTTACTTTACTAGG + Intergenic
1195131029 X:101852414-101852436 GGCCCCAGCTTTTCTTTATTGGG - Intronic
1196494170 X:116305174-116305196 TTCCCCAGCTTTTCTTTGTCTGG + Intergenic
1200503925 Y:3988787-3988809 GTCCCAGGCTTTACTTTACTAGG + Intergenic