ID: 1086647820

View in Genome Browser
Species Human (GRCh38)
Location 11:89246602-89246624
Sequence CTGTAGCTAAGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086647820_1086647827 26 Left 1086647820 11:89246602-89246624 CCTGCCTCCCTCCTTAGCTACAG 0: 2
1: 0
2: 3
3: 21
4: 334
Right 1086647827 11:89246651-89246673 TTTGGCTGTATTTTCCAGTGAGG 0: 1
1: 0
2: 3
3: 26
4: 350
1086647820_1086647826 8 Left 1086647820 11:89246602-89246624 CCTGCCTCCCTCCTTAGCTACAG 0: 2
1: 0
2: 3
3: 21
4: 334
Right 1086647826 11:89246633-89246655 CATCTTCTGGAGTGACATTTTGG 0: 1
1: 0
2: 6
3: 14
4: 178
1086647820_1086647825 -5 Left 1086647820 11:89246602-89246624 CCTGCCTCCCTCCTTAGCTACAG 0: 2
1: 0
2: 3
3: 21
4: 334
Right 1086647825 11:89246620-89246642 TACAGATTAATTACATCTTCTGG 0: 2
1: 1
2: 1
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086647820 Original CRISPR CTGTAGCTAAGGAGGGAGGC AGG (reversed) Intronic
900867212 1:5277064-5277086 CTGTTGCTTAGGAGAGAGTCGGG - Intergenic
901157466 1:7150137-7150159 CTGTCCGTAAGGAGTGAGGCAGG + Intronic
901215520 1:7552742-7552764 CTGCAGCAAAGCAGGGAGGCTGG + Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901770836 1:11529617-11529639 CTGGAGCTAAGCAGGCAGCCAGG - Exonic
902329685 1:15725226-15725248 CGTTAGCCCAGGAGGGAGGCAGG - Intronic
902686957 1:18083958-18083980 CTGAAGCTAGAGGGGGAGGCAGG + Intergenic
902885806 1:19403886-19403908 CTGGAGTCCAGGAGGGAGGCAGG - Intronic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903646109 1:24897358-24897380 CCGGGGCTGAGGAGGGAGGCAGG + Intergenic
903848170 1:26290715-26290737 GTGGAGCCATGGAGGGAGGCAGG + Intronic
904089578 1:27935351-27935373 CAGGAGCTAGGCAGGGAGGCAGG + Intronic
904092081 1:27952361-27952383 CTGGAACAAATGAGGGAGGCTGG - Intronic
904631941 1:31848974-31848996 CTGCAGCTAAGGAGAAAGCCCGG - Intergenic
905025846 1:34848743-34848765 ATGAAGCTAAGGAGGTGGGCAGG + Intronic
905890667 1:41516619-41516641 CTGGAGCGGAGGAGAGAGGCAGG - Intronic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907831761 1:58070962-58070984 CTGGAGCTCAGGAGAGAGCCTGG + Intronic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
911383900 1:97150331-97150353 CTGTAGCGAAGAAGAGAGACTGG - Intronic
912582881 1:110736054-110736076 CTATAGGAAAGCAGGGAGGCCGG - Intergenic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914751549 1:150538215-150538237 CTGCAGCCAGGGAGGCAGGCAGG - Intergenic
914755714 1:150560692-150560714 CCCTAGCTAATTAGGGAGGCAGG - Exonic
915013589 1:152712785-152712807 ATGGAGGTAAGGAGGGAGACAGG + Intergenic
915255655 1:154626995-154627017 TTGTTGCTAGAGAGGGAGGCAGG - Intronic
915684431 1:157617213-157617235 CTGTAGCAAAGGAGTGAGCAGGG + Intergenic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
921366798 1:214382014-214382036 CAGTTACTCAGGAGGGAGGCAGG - Intronic
922203251 1:223424779-223424801 ATGTAGCTCAAGAGAGAGGCTGG - Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923365219 1:233253365-233253387 CTGTTGCCAAGGCTGGAGGCTGG + Intronic
923480647 1:234379986-234380008 CTGTAACAAAGAAGGGAAGCAGG + Intronic
923627001 1:235622377-235622399 GTGTAGCTAAGGGGTGAGGCTGG + Intronic
924180772 1:241436875-241436897 CAGTAGCCAAGGAGGGAGTAGGG - Intergenic
924487174 1:244496367-244496389 CACTAGCTAAGGTTGGAGGCAGG + Intronic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
1063001764 10:1931278-1931300 CTGTTGCTAAGGTGGAAAGCGGG - Intergenic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1067205667 10:44209957-44209979 CTGGAGCAGAGGAGGTAGGCTGG + Intergenic
1067538910 10:47137504-47137526 CTACAGCTAAGGAGTCAGGCTGG - Intergenic
1067912339 10:50358657-50358679 CTGTTGCTCAGGCTGGAGGCTGG - Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1069838135 10:71322149-71322171 CTGTCTCTAAGGAGGGAAACTGG - Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074921688 10:118020616-118020638 CTGCAGCCCAGCAGGGAGGCAGG - Intronic
1075155658 10:119974261-119974283 TTCTCGCTAAGGAGGGAGGGGGG - Intergenic
1075278723 10:121120000-121120022 CTGCACCTAAGAAGGGAGGCAGG + Intergenic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077634266 11:3831287-3831309 CTGTAGCCTGGGAGGGAGGTGGG - Intronic
1078233122 11:9460664-9460686 TTGTAGCGAGGGAGGGAGGCTGG - Intronic
1078453044 11:11454456-11454478 AGGAAGATAAGGAGGGAGGCAGG + Intronic
1078617924 11:12882100-12882122 CTGTAGCTCAGGAGGGCCACAGG + Intronic
1079350475 11:19687562-19687584 CTGGAGCTATGGAGAAAGGCTGG + Intronic
1080030025 11:27650518-27650540 CACCAGCTATGGAGGGAGGCAGG + Intergenic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1080924706 11:36744264-36744286 CTATAGTTCAGGAGGCAGGCTGG + Intergenic
1081436447 11:43032640-43032662 CTTTTGCCAAGGAGGGAGACTGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082881681 11:58044299-58044321 CACCAGGTAAGGAGGGAGGCTGG - Intronic
1085028835 11:73257641-73257663 CTGGACCTCAGGAAGGAGGCTGG + Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085134781 11:74076616-74076638 ATGAAGCTAGGGAGGTAGGCAGG - Intronic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086337406 11:85812755-85812777 ATGAAGCTAAGGAGGTAGGTGGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1088072777 11:105810670-105810692 CTGTATCTCAGGAGGAAGGTCGG - Intronic
1088504415 11:110514310-110514332 CGGTAGGTAAGTAGGCAGGCAGG + Intergenic
1090172524 11:124617240-124617262 GAGCAGCTGAGGAGGGAGGCCGG - Intronic
1090419590 11:126565063-126565085 CAGGAGCTTGGGAGGGAGGCAGG + Intronic
1090671784 11:128952607-128952629 TTACAGCTAAGGAGGGAGGGAGG - Intergenic
1091702801 12:2674821-2674843 CTGTTGGTTAGAAGGGAGGCAGG + Intronic
1091704094 12:2681978-2682000 CTGGAGCTCAGGAGGGATTCAGG + Intronic
1091713622 12:2760503-2760525 CTGGAGCTCAGGAGGGATTCAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1096778528 12:53978524-53978546 CCGGAGCTAAGGAGGAATGCTGG + Intergenic
1100341493 12:93683694-93683716 ATGTATCTCAGGAGGGCGGCAGG - Intronic
1101850885 12:108401280-108401302 GGGAGGCTAAGGAGGGAGGCTGG - Intergenic
1101983746 12:109429736-109429758 CCTTACCTAAGGAGGGAGCCTGG - Intronic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102444692 12:112992838-112992860 CTGGAGTCAAGGAGGGAGACAGG + Intronic
1102491673 12:113293090-113293112 CTGGTCCGAAGGAGGGAGGCAGG + Intronic
1102837912 12:116083869-116083891 CTTTAACTAAGGAGGAATGCAGG - Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103704641 12:122864792-122864814 CTGTAGCTCTGCAAGGAGGCAGG + Intergenic
1103985994 12:124767798-124767820 CACTAACTGAGGAGGGAGGCAGG - Intergenic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1106999602 13:35527505-35527527 CAGGAGCTCAGGAGGGAGGCTGG - Intronic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113810834 13:113141465-113141487 CTGGAGCTAAGGTGCGGGGCTGG + Intronic
1115519960 14:34223536-34223558 CTCTAGTTTTGGAGGGAGGCAGG - Intronic
1116175765 14:41468684-41468706 TGGTAGCTAAAGAAGGAGGCTGG - Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119080579 14:71689837-71689859 CTGTAAGGAAGGAGGGAGGGAGG - Intronic
1119401505 14:74365653-74365675 CTGCAGCGGGGGAGGGAGGCAGG - Intergenic
1120911313 14:89669396-89669418 CTCTTGCTCAGGAGGCAGGCTGG - Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121873111 14:97427253-97427275 ATGTAGGTGATGAGGGAGGCAGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122202648 14:100131904-100131926 CTGTAGCTGAGGAGGCTGCCAGG + Intronic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1123983757 15:25625912-25625934 CTGAAGACAAGGAGGGTGGCTGG + Intergenic
1124400462 15:29343489-29343511 CTGTAGGGCAGCAGGGAGGCTGG - Intronic
1124635256 15:31361021-31361043 CTGCAGCTGAGGAAGGAGCCAGG - Intronic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1126873052 15:53010154-53010176 CTGGAGTTCAGGAGAGAGGCTGG + Intergenic
1127286960 15:57540976-57540998 CTCTGCCTAAGGATGGAGGCAGG + Intronic
1127729828 15:61789547-61789569 CTTTATATAAGGAAGGAGGCAGG - Intergenic
1128064498 15:64755900-64755922 CTTTAGTTAAGGAGTGAGGAAGG - Intronic
1128566013 15:68700707-68700729 CCGCAGCTAGGGAGGGCGGCTGG + Intronic
1129380114 15:75159492-75159514 CTATAGCAAAGAAGGGAGGAAGG - Intergenic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129942756 15:79512599-79512621 CTGTAACTGTGAAGGGAGGCTGG + Intergenic
1129942820 15:79512958-79512980 CTGTAACTGTGAAGGGAGGCTGG + Intergenic
1130552280 15:84897779-84897801 CTGAAGGGGAGGAGGGAGGCGGG - Intronic
1131636342 15:94236833-94236855 TTGTAGATCAGGAGGGAGGTAGG + Intronic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1134718305 16:16367778-16367800 CAGTAGATGAGCAGGGAGGCTGG - Intergenic
1134956447 16:18384381-18384403 CAGTAGATGAGCAGGGAGGCTGG + Intergenic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1137238648 16:46636276-46636298 CTGTTGATAATGGGGGAGGCTGG + Intergenic
1137600820 16:49755047-49755069 CTCCTGCTGAGGAGGGAGGCAGG - Intronic
1138900693 16:61265511-61265533 ATGAAGGGAAGGAGGGAGGCGGG - Intergenic
1139491498 16:67288472-67288494 CAGCAGCTAGGGAGGGAGACTGG - Exonic
1139596875 16:67963398-67963420 CTTTAGCTAAGCAGGCAGGCTGG - Intronic
1139696435 16:68678586-68678608 CTGTAGAGAAGGAGACAGGCTGG + Exonic
1141421984 16:83923591-83923613 CTCTAGGGAAGGAGGCAGGCTGG - Exonic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143286687 17:5795134-5795156 TTCTAGCTCAGGTGGGAGGCAGG + Intronic
1143501397 17:7341607-7341629 CTGGATCTAAGCAGGTAGGCAGG + Intronic
1143702988 17:8675323-8675345 GTGTATGTAAGTAGGGAGGCTGG - Intergenic
1144495228 17:15741564-15741586 CTGTAGGGAGGGAGGGTGGCTGG - Intronic
1145284429 17:21494849-21494871 GTGTTCCTAAAGAGGGAGGCAGG - Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1147426203 17:40346993-40347015 CTGCAGGTAAGGGGGGAGGGTGG + Intronic
1147638233 17:41977097-41977119 CTGTTGCTAAGGATGAAGACAGG - Exonic
1147669591 17:42169378-42169400 CTGTAGCTTAAAATGGAGGCAGG - Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150810414 17:68352016-68352038 CTGGACATAAGGAGGGAGGGAGG + Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151669631 17:75564986-75565008 CTCTAGCTGGGGAGGGTGGCAGG - Intronic
1151850483 17:76686925-76686947 GTGCAGATAAGGGGGGAGGCTGG + Intronic
1154284020 18:13034863-13034885 CTGTCGGCAAGGAGGAAGGCAGG - Intronic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1156034878 18:32754960-32754982 CTGCAGCAAGGGAGGGAGGCAGG + Intronic
1156760726 18:40585781-40585803 CTGAAGTGAAGGAGGGAGTCTGG + Intergenic
1157302463 18:46488934-46488956 CATTGGCTCAGGAGGGAGGCAGG - Intronic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1157898598 18:51491876-51491898 TTGTAGTTAGAGAGGGAGGCAGG - Intergenic
1158405801 18:57158127-57158149 CTGTGGCCAAGGAGAGATGCAGG - Intergenic
1158517992 18:58146693-58146715 CAGTGGCTAGGGAGGCAGGCAGG + Intronic
1158680908 18:59565721-59565743 CTGTAGCTAAGAGGGGAAGACGG + Intronic
1158755962 18:60325814-60325836 CTATAGCTTTGGAGGGAGGGAGG + Intergenic
1159408801 18:68042412-68042434 ATGTAGCAAATGAAGGAGGCTGG + Intergenic
1161325784 19:3663365-3663387 GTGTGGCTTAGGAGGGAGACAGG - Intronic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163862546 19:19749827-19749849 CTGGAGCTAAGCTGGTAGGCAGG - Intergenic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165730463 19:38141582-38141604 CTGAAACGAAGGAGGGAGGGAGG - Intronic
1166534256 19:43562296-43562318 CTGTATGGAAGGAGGGAGCCTGG + Intronic
1167303943 19:48696278-48696300 AGGGAGCTAAGGAGGGCGGCTGG - Intronic
1168516298 19:57012948-57012970 CTGGAGCTCATGAGGGAGTCTGG + Intergenic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925471444 2:4165730-4165752 ATGTTGCTAATGTGGGAGGCTGG - Intergenic
925911199 2:8574658-8574680 CTGTGTCCAAGGAGGAAGGCGGG + Intergenic
926156885 2:10460580-10460602 CTGGAGCTAACGTGGGAGGCTGG + Intergenic
926180060 2:10634540-10634562 CTGTAGCTCAGAGGGAAGGCTGG + Intronic
927105887 2:19825089-19825111 GTGTAGCTGAGGTAGGAGGCAGG + Intergenic
927859832 2:26553719-26553741 CCGGAGCTCAGAAGGGAGGCGGG - Intronic
928170500 2:28999988-29000010 TTGAAGCCAAGAAGGGAGGCTGG - Intronic
928225953 2:29448300-29448322 CAGTAATTTAGGAGGGAGGCTGG + Intronic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
931669182 2:64631238-64631260 CTGGAGCTCAGGAGAGAGGCAGG + Intergenic
932199296 2:69811586-69811608 CTCAAGCTCAGGAAGGAGGCCGG - Intronic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
934523692 2:95035486-95035508 CTCTAGCTCATGAGGGAGGTGGG + Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935344576 2:102093948-102093970 GTGAAGCTCAGGACGGAGGCAGG - Intronic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
936462905 2:112725102-112725124 CTCTAGCTAGGGAGGGTCGCAGG - Intronic
937305454 2:120867803-120867825 CTGGAGGGAAGGAGGGAGGGAGG + Intronic
937903960 2:127042896-127042918 CTGGAGCTCAGGAGAGAGACGGG - Intergenic
938316268 2:130331312-130331334 CTGTAGCTCAGTGGAGAGGCTGG - Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
942628533 2:177930307-177930329 CTGTAGCCAAGCAGGCAAGCAGG + Intronic
942967774 2:181917688-181917710 CTACAGCTAAGGAATGAGGCTGG - Intronic
947474514 2:230430882-230430904 CTGTAGTTAGGCAGGGTGGCTGG + Intronic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
948132207 2:235609008-235609030 AAGAAGCTAAGGAGGGAGGAAGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168862618 20:1056752-1056774 CAGTTGCCAAGGTGGGAGGCTGG - Intergenic
1168931360 20:1626885-1626907 CTGTAGCTAAGGACTGAGTTTGG + Intergenic
1168956486 20:1837851-1837873 CTGAAGCTGAGGAGGCTGGCTGG + Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172221263 20:33276644-33276666 CTGAAGCTCAGGAGGGAGCTGGG - Intronic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1176276334 20:64271960-64271982 CTGTACTTGAGGAGGGAGCCGGG + Intronic
1177733766 21:25062684-25062706 CTGTCACTAAAGAGAGAGGCAGG - Intergenic
1179399648 21:41071700-41071722 CTGTAGCTTAAGAGGGAGGCAGG - Intergenic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1181100003 22:20532663-20532685 CTCTAGCTGAGGAAGGGGGCTGG - Intronic
1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG + Intergenic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183055084 22:35300198-35300220 CAGTAGGTAAGGAGAGAGGGTGG + Intronic
1183369529 22:37424661-37424683 CTGTAGCCACTGAGGGCGGCGGG + Intronic
1184434462 22:44461819-44461841 CTGGAGCTCAGGAGAGATGCTGG - Intergenic
1185109022 22:48890529-48890551 CTGCAGGTAAGGAGAGAGCCTGG - Intergenic
949458463 3:4264298-4264320 CTGGAGCTAATGAGGGAATCTGG + Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
952564482 3:34638447-34638469 CTGTTACTAAGGTAGGAGGCAGG - Intergenic
954881316 3:53837759-53837781 GTGTATGTAAGGTGGGAGGCCGG + Intronic
955274845 3:57537354-57537376 TAGTAGCTAAGGAAGAAGGCAGG + Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
959063873 3:101638393-101638415 CTGCAGCTCAGGAGGCAGCCCGG + Intergenic
962209348 3:133464030-133464052 ATGTAGCTACAGAGGGTGGCGGG - Intronic
962956820 3:140274337-140274359 CTGCTGCTTATGAGGGAGGCTGG + Intronic
964459971 3:156913587-156913609 CTGTAGCTAAGGATAGAGAGTGG + Intronic
966311026 3:178594039-178594061 GGGTAGGTAAGGAGGGAGGGAGG - Intronic
967248280 3:187510979-187511001 ATGTAGCTCAAGTGGGAGGCAGG + Intergenic
968795683 4:2702609-2702631 CTGTAGCACAGGAGTGGGGCTGG - Intronic
968979263 4:3837804-3837826 TTATAGATAAGGAGGGTGGCTGG - Intergenic
969230447 4:5826781-5826803 CTGCAGAGAAGGAGGGAGCCAGG - Intronic
969476228 4:7423979-7424001 CTGTGGCTTAGGAGGATGGCAGG + Intronic
969586587 4:8097560-8097582 CTCTAGCGAGGGTGGGAGGCTGG - Intronic
970310384 4:14776719-14776741 CTTAAGCTAAGGGGGAAGGCTGG - Intergenic
970365075 4:15350164-15350186 AGGGAGCGAAGGAGGGAGGCAGG + Intronic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
972267267 4:37473833-37473855 CTGTAGCTGTGTAGGGGGGCAGG - Intronic
972400253 4:38695152-38695174 CTCTAGCAAAGGAGGGAGAAAGG + Intronic
972721964 4:41708807-41708829 CAGGAGCTAAGGAGGAAGGATGG - Intergenic
974039045 4:56842295-56842317 CAGTAGCTAAGGTGGATGGCAGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
983980296 4:173987418-173987440 CTGAAGCTGAGGAGTGAGCCTGG - Intergenic
984215746 4:176910960-176910982 CTGGAGCTAAGGAGGCTGGATGG + Intergenic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
986340462 5:6784695-6784717 CTTTAGAGAAGGAGGGAGCCAGG + Intergenic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
991379776 5:66007858-66007880 CAGCAGCTAAGGAGGGAGGTGGG + Intronic
991412402 5:66358018-66358040 CAGAAGCTAAGCAGCGAGGCAGG - Intergenic
992752805 5:79876343-79876365 ATGTAGCTTAGCAGAGAGGCTGG + Intergenic
992760567 5:79947849-79947871 CAGTAGTTTAGGAGGGAGGGGGG + Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
993886699 5:93423228-93423250 CTGTAGCTAAGGAGAGGCCCCGG - Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998498732 5:142613892-142613914 CTGTAGTCAAGGTGGGAGGAAGG - Intronic
1000690908 5:164319751-164319773 ATGTATAAAAGGAGGGAGGCAGG - Intergenic
1001897149 5:175392391-175392413 CTGTAGCTCAGGCAGTAGGCCGG + Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1003435218 6:6081826-6081848 CTGGAGCTCAGGTGAGAGGCTGG + Intergenic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1004044735 6:12012595-12012617 CTGCAGCTGGGGAGGGCGGCGGG + Intronic
1005042610 6:21612790-21612812 CTGTATCTAAAGGAGGAGGCTGG - Intergenic
1005458254 6:26042706-26042728 CTGTAACAAAGGAAGAAGGCAGG + Intergenic
1005695195 6:28345355-28345377 GGGTAGCTAATGATGGAGGCTGG - Intronic
1006381406 6:33699882-33699904 TTGTCCCTAAGGAGGGGGGCCGG - Intronic
1007322809 6:41039426-41039448 CTGGAAGGAAGGAGGGAGGCAGG + Intronic
1009996415 6:70900340-70900362 CTCCAGGAAAGGAGGGAGGCAGG + Intronic
1010003233 6:70969200-70969222 GTGTAGCTTAAGAGAGAGGCAGG + Intergenic
1010547288 6:77173761-77173783 CTGGAGCTAAGTATGGAGCCCGG - Intergenic
1013493842 6:110677952-110677974 CTGAAGCTAAGGCAGGAGGATGG - Intronic
1016797163 6:148130484-148130506 CTGTAGCTGAGCAGGCAGGAAGG - Intergenic
1017220546 6:151961104-151961126 CTGGAGTTTAGGAGAGAGGCTGG + Intronic
1018344587 6:162887716-162887738 ATGTATTTAAGGACGGAGGCAGG - Intronic
1019499080 7:1355452-1355474 ATGGAGCTCAGGAGGGAGCCAGG - Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023106916 7:36771642-36771664 GTGTGGCCAAGGAAGGAGGCTGG - Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024465298 7:49705911-49705933 CTGTAGAAAAGGAGGAGGGCAGG - Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1026931038 7:74223119-74223141 CTGGAGAGAGGGAGGGAGGCAGG - Intronic
1028228765 7:88280744-88280766 CTGTAGATATGGAGGCAGTCAGG + Intronic
1029160541 7:98548631-98548653 ATGTAGATAAGTAGGTAGGCAGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1031197955 7:118640551-118640573 TTGTAGCTAAAATGGGAGGCAGG - Intergenic
1031360997 7:120848200-120848222 CTGTAGGTAAGGCGGGAGTTGGG - Intronic
1031443471 7:121822321-121822343 CTTTAGCTAGGGTGGGAGTCAGG - Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1033605801 7:142927888-142927910 CTGGAGCTAAGCAGAGAGACAGG + Intronic
1033607861 7:142940589-142940611 CTGGAGCCCAGGAGGGAGGGAGG - Exonic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035253689 7:157613132-157613154 CTGCGGCTGAGGCGGGAGGCGGG - Intronic
1036162986 8:6406511-6406533 CTGTAGGTGAGGCGGGAGGCTGG - Intergenic
1037586569 8:20280773-20280795 CTGGATCTAAGGAGGAAGGATGG - Intronic
1037762056 8:21748065-21748087 CTAGAGCTCAGGAGGGAGTCTGG - Intronic
1038173906 8:25163700-25163722 CTGTTACTAAGGAAGGAGGGAGG + Intergenic
1040587536 8:48757548-48757570 CTGTAGGTAAGGAGTGGGGTAGG + Intergenic
1040703564 8:50097488-50097510 TTGAAACTAAGGAGAGAGGCCGG + Intronic
1042739798 8:72030407-72030429 CTGTGGCTAAAGTGGGAGACTGG + Intronic
1047037417 8:120955189-120955211 CTGCAGCTCAGGAGGGAGTTGGG - Intergenic
1049349283 8:142155354-142155376 CTGGAGCTGAGCAGGGAGCCTGG - Intergenic
1049471803 8:142778006-142778028 CTGTAGCAAAGCTGGAAGGCAGG + Exonic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1051842470 9:21414043-21414065 CTGCTGCTAGGGATGGAGGCAGG + Intronic
1053062795 9:35044819-35044841 CTTCAGCTAGGGTGGGAGGCTGG - Exonic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057895505 9:98905521-98905543 GTGCAGCGAAGGAGGGAGGGAGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061940404 9:133880895-133880917 CCGTGGCTCAGGATGGAGGCAGG + Intronic
1062304243 9:135894035-135894057 CTGTTGCTAGGCAGGGAGTCAGG - Intronic
1062503154 9:136859817-136859839 CTGGGGCTAAGGAGGAAGCCTGG - Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1186434891 X:9534022-9534044 CGGGAGCAAGGGAGGGAGGCAGG + Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1189397801 X:40639129-40639151 CTATAGCAAGGGAGGGAGGAGGG + Intronic
1189884349 X:45525642-45525664 TTGTAGCTAATGAGGGATGGTGG + Intergenic
1190332340 X:49243446-49243468 CTGTACCTGGGGTGGGAGGCGGG - Exonic
1190461320 X:50678867-50678889 CTTTAGAAAAGGAGGGTGGCAGG - Intronic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1194655872 X:96572547-96572569 TTCAAGCTAAGGAGAGAGGCTGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197284417 X:124579314-124579336 CTGTAGCAAAGGATGCAAGCTGG - Intronic
1197526847 X:127575050-127575072 CACGAGCTCAGGAGGGAGGCTGG + Intergenic
1198225520 X:134641636-134641658 CTGTAGCTTAGGGTGGAGGTGGG + Intronic
1198374992 X:136029952-136029974 CTGTTGCTAAGGAAAGTGGCAGG + Intronic
1198459249 X:136847451-136847473 CTGTAGCTAAGGAGGTCTTCCGG - Intergenic
1198756381 X:139986867-139986889 CTGTTGCCCAGGATGGAGGCTGG + Intergenic
1200138039 X:153884398-153884420 GTGTAGCAAACCAGGGAGGCTGG + Intronic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic