ID: 1086654288

View in Genome Browser
Species Human (GRCh38)
Location 11:89332183-89332205
Sequence ACTCGTTGTATTACAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 2, 1: 0, 2: 1, 3: 1, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086654285_1086654288 -6 Left 1086654285 11:89332166-89332188 CCCCGGAGAGCTTATTCACTCGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1086654288 11:89332183-89332205 ACTCGTTGTATTACAGATCCAGG 0: 2
1: 0
2: 1
3: 1
4: 42
1086654286_1086654288 -7 Left 1086654286 11:89332167-89332189 CCCGGAGAGCTTATTCACTCGTT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1086654288 11:89332183-89332205 ACTCGTTGTATTACAGATCCAGG 0: 2
1: 0
2: 1
3: 1
4: 42
1086654287_1086654288 -8 Left 1086654287 11:89332168-89332190 CCGGAGAGCTTATTCACTCGTTG 0: 2
1: 0
2: 0
3: 9
4: 77
Right 1086654288 11:89332183-89332205 ACTCGTTGTATTACAGATCCAGG 0: 2
1: 0
2: 1
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086654288 Original CRISPR ACTCGTTGTATTACAGATCC AGG Intronic
1077906605 11:6539354-6539376 ACTGGCTTTATTACAGGTCCTGG - Intronic
1078134815 11:8643074-8643096 ACAAGTTGTAACACAGATCCTGG - Exonic
1082201385 11:49374058-49374080 ACTCGTTGTATTACAGATCCAGG - Intergenic
1086654288 11:89332183-89332205 ACTCGTTGTATTACAGATCCAGG + Intronic
1095166510 12:38979849-38979871 AGTTGTTGGATTAGAGATCCTGG + Intergenic
1098802066 12:74973166-74973188 ACTCGTTTTATGACAGATCCAGG + Intergenic
1110547959 13:76777739-76777761 AATCAATGAATTACAGATCCTGG - Intergenic
1112912351 13:104503080-104503102 ATTGGTTGAATAACAGATCCTGG + Intergenic
1114737071 14:25052524-25052546 ACTTGTTATGTGACAGATCCTGG - Intergenic
1116434878 14:44885906-44885928 AGTCTTTGCATTACATATCCAGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
926654724 2:15389242-15389264 ACTGGTTGTATTACATAAGCTGG - Intronic
937740477 2:125346871-125346893 ACTCGATGTCTTAAAGAGCCAGG - Intergenic
938980978 2:136526852-136526874 ACTCGTTGTCTCACAAAACCTGG - Intergenic
942348921 2:175032174-175032196 ACTCTTTGGATTACAGCTCTTGG + Intergenic
947222897 2:227811290-227811312 ATTTGTTGTATTACATTTCCTGG + Intergenic
1173110455 20:40182806-40182828 ACCCATTGTATTACAGGCCCTGG + Intergenic
1177976061 21:27852355-27852377 ATTCCTTGTAGAACAGATCCAGG + Intergenic
956956130 3:74343119-74343141 ATTAGTTGTATTACAGATAAAGG + Intronic
961348294 3:126279028-126279050 ACTGGTTGGTTTAAAGATCCTGG - Intergenic
961476380 3:127149191-127149213 ACACGTGGTATTATAGATGCTGG - Intergenic
967182247 3:186916226-186916248 ACACGTTGTGTAACAGAGCCTGG - Intergenic
970936959 4:21583438-21583460 ACTTATTGTATGTCAGATCCTGG - Intronic
971693408 4:29867087-29867109 TCTGGTTGTTTGACAGATCCTGG + Intergenic
975032825 4:69643622-69643644 ACTCATTTTATTTCAGATCATGG - Intronic
977546034 4:98379001-98379023 ACTCTTTGTTTTACAGATGAGGG + Exonic
977731593 4:100359942-100359964 ACTCCTTGCATTTCAGCTCCTGG - Intergenic
994454894 5:99993365-99993387 ATTTTTGGTATTACAGATCCTGG - Intergenic
997061854 5:130515340-130515362 AACCCTTGTATTATAGATCCTGG + Intergenic
999942332 5:156557353-156557375 ACTTGTTGTTGTACAAATCCTGG - Intronic
1005012544 6:21349630-21349652 ACTCCTTGTATTATAGATGATGG + Intergenic
1011290388 6:85770891-85770913 GTTCCTTGTATTACAGATTCTGG + Intergenic
1012376534 6:98568247-98568269 ACTCGATGTATTACATGTCTTGG - Intergenic
1015394452 6:132718778-132718800 ACTTGTGATATTACAGTTCCTGG - Intergenic
1023642164 7:42270252-42270274 ACTCATCATATTACAGATTCAGG - Intergenic
1023714246 7:43026966-43026988 ACTCTTTGTATTTCACATTCTGG - Intergenic
1030729483 7:112969050-112969072 ACTCTTTGTCTGAGAGATCCAGG + Intergenic
1032748681 7:134814176-134814198 ACCCTTTGTATCACAGAGCCTGG - Intronic
1037698497 8:21249638-21249660 ACACGTCATATTACAGATCCAGG - Intergenic
1041608962 8:59821124-59821146 ACTCCTTGTATTCCAGGTTCTGG - Intergenic
1189167353 X:38873647-38873669 AATTTTTTTATTACAGATCCTGG - Intergenic
1192658599 X:73019492-73019514 ACTGGTTGTTTTAAAGAGCCTGG - Intergenic
1194363212 X:92980702-92980724 ACTCTTTGTATCACAGATATGGG - Intergenic
1198135007 X:133740206-133740228 AATCAATGTATTACAGATTCAGG + Intronic
1198723661 X:139653078-139653100 ACTCGATATATTTCAGATCAAGG + Intronic
1201586401 Y:15565652-15565674 ACTTGTTGTATTATAGAAGCAGG + Intergenic