ID: 1086655972

View in Genome Browser
Species Human (GRCh38)
Location 11:89355682-89355704
Sequence CCAGCAGTACATAAGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086655972_1086655976 -7 Left 1086655972 11:89355682-89355704 CCTAAGCTCTTATGTACTGCTGG 0: 1
1: 0
2: 3
3: 15
4: 127
Right 1086655976 11:89355698-89355720 CTGCTGGTGGGAGTCCAAATTGG 0: 2
1: 5
2: 51
3: 485
4: 1893
1086655972_1086655978 19 Left 1086655972 11:89355682-89355704 CCTAAGCTCTTATGTACTGCTGG 0: 1
1: 0
2: 3
3: 15
4: 127
Right 1086655978 11:89355724-89355746 AATAGCTATTGAAGACAATTTGG 0: 1
1: 1
2: 1
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086655972 Original CRISPR CCAGCAGTACATAAGAGCTT AGG (reversed) Intronic
900769377 1:4528657-4528679 CCAGCAGTGCGCAAGGGCTTTGG - Intergenic
903999403 1:27330434-27330456 CCAGCAGTGAATGAGAGCTCTGG + Intronic
906907053 1:49906804-49906826 CCACCAGCACATGAAAGCTTAGG + Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908777467 1:67654651-67654673 CCAGCAGTGTATGAGAGTTTTGG + Intergenic
909447890 1:75767842-75767864 CCTGTAGTACCTAAGAGCTTGGG + Intronic
909506384 1:76395318-76395340 CCAACAGTGTATAAGAGCTCAGG - Intronic
911112133 1:94200421-94200443 CCAGCAGTGTATGAGAGTTTTGG - Intronic
912097481 1:106163139-106163161 TCAGCAGTTCATAAGAGCTGAGG - Intergenic
913527892 1:119711733-119711755 CCAGGTGTAGGTAAGAGCTTTGG + Intronic
917031419 1:170696437-170696459 CCAGCAGTCCAGAAGAGATGTGG + Intronic
918127432 1:181596848-181596870 TCAGCAGTACATATGTCCTTAGG + Intronic
920438445 1:205963080-205963102 CCAGCAGGACGTCAGAGCTTGGG - Intergenic
920707550 1:208265623-208265645 CATGCAGTACATCAGTGCTTTGG + Intergenic
921078321 1:211717764-211717786 CCAGCAGTGCATGAGAGTTCAGG + Intergenic
921193542 1:212730694-212730716 CCTGCAGGACATAAGAGCAGAGG - Intronic
921460957 1:215426395-215426417 CCAGCAGTATATAAAAGTTTTGG + Intergenic
921743015 1:218707960-218707982 CCAGCAGCAGATAAGAGGTAAGG - Intergenic
921831741 1:219734854-219734876 CCAGGTGTAAATAAGACCTTGGG + Intronic
1065587724 10:27236585-27236607 CTAGCAGTTTATAAGAGCTGTGG + Intronic
1067789038 10:49273657-49273679 TCTGCATTACATTAGAGCTTTGG - Intergenic
1069523595 10:69147036-69147058 CCAGCAATATATAAGGGTTTTGG + Intronic
1069725143 10:70572651-70572673 GAAGCAGTTCAAAAGAGCTTGGG + Intergenic
1073685422 10:105747282-105747304 CCAGCAGTATATAAGGGTTCTGG - Intergenic
1075218467 10:120561093-120561115 CCAGCAGTCCTTTAGCGCTTTGG + Intronic
1077650650 11:3968991-3969013 ACAGCAGTACTTAAGAGCATGGG - Intronic
1079279673 11:19076016-19076038 CCAGCAGTGAATAAGAGTTATGG + Intergenic
1080871018 11:36237069-36237091 AAAGCAGTACATGAGAACTTGGG + Intergenic
1082199693 11:49350543-49350565 CCAGCAGTGTATAAGAGCTTAGG + Intergenic
1083525470 11:63360947-63360969 CAAGCAGGACATATCAGCTTAGG - Intronic
1085878948 11:80442709-80442731 CCAACTGAACAGAAGAGCTTTGG - Intergenic
1086352262 11:85954088-85954110 CCTGCAGCACAAAAGAGCCTTGG - Intergenic
1086655972 11:89355682-89355704 CCAGCAGTACATAAGAGCTTAGG - Intronic
1090541447 11:127710965-127710987 TCAGCATTGCAGAAGAGCTTTGG - Intergenic
1095739035 12:45587117-45587139 CCAGCAGAGCATAAAATCTTAGG - Intergenic
1097730493 12:63123317-63123339 CCAGCAGGACAACAGAGCATGGG + Intergenic
1101953726 12:109196217-109196239 CCAGGAGCACACAAGAGCTTTGG - Intronic
1103728722 12:123012323-123012345 CCAGAAGTACATATGGGCTCGGG - Intronic
1105386989 13:19939761-19939783 GAAGCACTATATAAGAGCTTGGG - Intergenic
1108971764 13:56384718-56384740 CCAGCAGTGTATAAGAGTTGTGG + Intergenic
1108974565 13:56422264-56422286 CAAGCAGCACCTAAAAGCTTAGG + Intergenic
1110377563 13:74809783-74809805 CCAGCAGAACATAATGTCTTGGG + Intergenic
1111642407 13:90985293-90985315 ACAACAGTACAAAAGTGCTTAGG + Intergenic
1111715164 13:91870422-91870444 CGATCATTTCATAAGAGCTTAGG - Intronic
1114183765 14:20385002-20385024 CCGGAAGTAGATGAGAGCTTGGG + Exonic
1115913296 14:38280810-38280832 GCAGCAAAACATAAGAGCTAGGG - Intergenic
1119606481 14:76022402-76022424 CCAGCAGCTCATAAGAGTATGGG + Intronic
1120310029 14:82815231-82815253 GCAGCAGTACAGTACAGCTTCGG + Intergenic
1127257384 15:57303613-57303635 CCAGCATTTCATCCGAGCTTAGG - Intergenic
1128447889 15:67780880-67780902 TCAGCAGCACATATGATCTTTGG + Intronic
1128525698 15:68410861-68410883 CCTTCATTACAGAAGAGCTTGGG + Intronic
1138493164 16:57389511-57389533 CCAGATGTACATAAGCGCTCAGG + Intergenic
1140784953 16:78331981-78332003 CAAGCAGTACATCAGAGCCGAGG + Intronic
1141020562 16:80492087-80492109 CCAGGATTACGTGAGAGCTTGGG - Intergenic
1141358980 16:83376908-83376930 CCAGCACCACATAAGAAGTTTGG + Intronic
1142985758 17:3694746-3694768 CCAGCAGCACTTAACTGCTTAGG - Intronic
1144206077 17:12980354-12980376 CCATCTGGACATTAGAGCTTTGG + Intronic
1144249221 17:13398941-13398963 CCAACAGCACATGAGAACTTAGG - Intergenic
1146451381 17:32976884-32976906 CCACCAGTGCCTAAGTGCTTAGG - Intronic
1146634453 17:34493735-34493757 GCAGCACTACAAAAGAGCTTGGG + Intergenic
1147788560 17:42998232-42998254 CCAGCAGTAGACAAGAGCAAAGG - Intergenic
1153083655 18:1257902-1257924 CCAACAGTGTATAAGAGTTTGGG - Intergenic
1153248095 18:3093316-3093338 CCAGCAGTACTGAAGAACTGGGG - Intronic
1153781549 18:8499459-8499481 CAAGCACTACATCTGAGCTTTGG + Intergenic
1156801737 18:41123293-41123315 CCAGTAGTGCATAAGAGCTTTGG - Intergenic
1157048167 18:44127760-44127782 CCAACAGTACTTCATAGCTTAGG + Intergenic
1166403047 19:42498050-42498072 CCAGCCGCACATCACAGCTTAGG + Intergenic
926215702 2:10903801-10903823 GCAGCAGTACAGTACAGCTTTGG + Intergenic
926695593 2:15768171-15768193 CCAGATGCCCATAAGAGCTTTGG - Intergenic
927719868 2:25375752-25375774 CCTGCAGCCCATAAGCGCTTCGG - Intergenic
928716588 2:34068226-34068248 CCAGCAGTAAAGAAGATTTTGGG - Intergenic
930459140 2:51648591-51648613 CCACCCAGACATAAGAGCTTAGG + Intergenic
930888285 2:56353489-56353511 CCAGGTGTAAATAAAAGCTTGGG + Intronic
931201842 2:60105267-60105289 CCACCAGCAAATAAGAGATTTGG - Intergenic
933394264 2:81711825-81711847 CCAGCAGAACATAATATCTTGGG + Intergenic
933985457 2:87588145-87588167 CCAGCAAGACAGAAAAGCTTTGG - Intergenic
934902859 2:98174643-98174665 CCAGGAATACCTCAGAGCTTTGG - Intronic
935415980 2:102819761-102819783 CCAGCAAAACTTAAGAGTTTGGG - Intronic
936308384 2:111362656-111362678 CCAGCAAGACAGAAAAGCTTTGG + Intergenic
937546056 2:123022342-123022364 TCAGCAGAACATAAGACGTTTGG - Intergenic
938556813 2:132431935-132431957 TCAGCAGGACCTTAGAGCTTAGG + Intronic
1169613041 20:7404947-7404969 CCAGGAATACATCAAAGCTTTGG + Intergenic
1169793750 20:9439572-9439594 ACAGCAGTATAGAAAAGCTTTGG + Intronic
1170779527 20:19411790-19411812 CCAGTAGTACATTATAACTTTGG + Intronic
1174764486 20:53239555-53239577 CCAGCAGTAGAGAAGACCTTGGG + Intronic
1176151290 20:63592430-63592452 CCAGCAGCACAGAAGGGCCTAGG + Intronic
1178274903 21:31228318-31228340 CCAGCAGTGCATAGGAGTTCTGG - Intronic
1181748952 22:24975888-24975910 CCAGCAGGAGATGAGAGCTTTGG + Intronic
950081087 3:10222630-10222652 CCAGCAAGACATTAGAGCTGTGG - Exonic
951002417 3:17578924-17578946 ACAGAAGTACATAAGAGCAGAGG + Intronic
951465464 3:22996596-22996618 CCAGCAGTCCAAAAGGACTTTGG - Intergenic
952491363 3:33876752-33876774 CCAGAAGTCCAGATGAGCTTTGG + Intergenic
955837566 3:63073401-63073423 CCAACACTACATATGAGTTTTGG + Intergenic
955962391 3:64354224-64354246 CTAGCACAACAGAAGAGCTTTGG + Intronic
956830638 3:73044289-73044311 CCAGCAATGCACAAGAGTTTTGG + Intronic
957743125 3:84300469-84300491 CCAGGAGTACAAAATAGCATGGG - Intergenic
958229706 3:90883587-90883609 CAAGCATCACAAAAGAGCTTCGG - Intergenic
958232138 3:90924366-90924388 CAAGCATCACAAAAGAGCTTCGG - Intergenic
958241653 3:91084069-91084091 CAAGCATCACAAAAGAGCTTCGG - Intergenic
958247175 3:91176679-91176701 CAAGCATCACAAAAGAGCTTCGG - Intergenic
958247470 3:91181777-91181799 CAAGCATCACAAAAGAGCTTCGG - Intergenic
960214884 3:115020184-115020206 CCTGTATTACATAAGAGCCTGGG - Intronic
962088519 3:132218137-132218159 CCAGCAGTACATTGCAGCCTGGG - Intronic
968826796 4:2904225-2904247 CCAGCAGTCAATAAGAGCAACGG + Intronic
968838588 4:2983335-2983357 CCAGGAGAACATAATGGCTTAGG - Intronic
973682711 4:53337494-53337516 CCAGCAATACATATGAGTTCTGG - Intronic
974076445 4:57172589-57172611 GCAGCAGTACAGGACAGCTTCGG - Intergenic
976623388 4:87152362-87152384 CCAGCAGTTCATACCAGCCTGGG + Intergenic
977058200 4:92219828-92219850 CATGCAGTAGATAAGATCTTTGG - Intergenic
978404138 4:108362010-108362032 CAATCAGTATATAAGAGGTTGGG + Intergenic
981081164 4:140640750-140640772 CCAGCAGTATATAAGAGTTTTGG - Intronic
984418075 4:179486154-179486176 CCAGCAGACCATAATAGCATGGG + Intergenic
985166823 4:187104948-187104970 CCAGCAGAAAATAAGAGTATAGG - Intergenic
992170969 5:74101864-74101886 CCAGCTTTAAATAAGAGCTCTGG - Intergenic
1002325395 5:178401751-178401773 CTAGCAGTATATGAGAGCTCTGG + Intronic
1005093904 6:22090048-22090070 CCAGCAGTGAATAAGAGTTCTGG + Intergenic
1005938862 6:30546089-30546111 CCAGCAGGGCATAAGGGTTTCGG + Exonic
1011804322 6:91053303-91053325 CCAGCAGTACATGAGAGTTGCGG + Intergenic
1013637952 6:112047160-112047182 GCAGCAGTACAGTACAGCTTCGG - Intergenic
1013669126 6:112379145-112379167 CCATCAGTATATGAGAGTTTAGG + Intergenic
1014245686 6:119065909-119065931 GCAGTAGTACATGAGAGCTAAGG + Intronic
1015509075 6:134019724-134019746 CTAGAAGTACATAAGATGTTGGG + Intronic
1030396959 7:108997779-108997801 TCAAGAGTACATCAGAGCTTTGG + Intergenic
1031862078 7:126992176-126992198 TCAGGAGAGCATAAGAGCTTAGG - Intronic
1032031480 7:128487308-128487330 CCAACAGTGCAGAAGAGCTCTGG + Intronic
1034507506 7:151505528-151505550 CTAGCAGCACATGAGAGCTTTGG - Intronic
1035870537 8:3132793-3132815 CCAGAAAGAAATAAGAGCTTGGG - Intronic
1037086995 8:14864786-14864808 CCAACAGTATATAAGAGCTCCGG + Intronic
1037644251 8:20775932-20775954 CCAGCAGGAGATTAGAGGTTGGG - Intergenic
1038454245 8:27662121-27662143 CCAGCAGAACATAAGGTCATAGG + Intronic
1039527050 8:38226231-38226253 CCAGCAGAGCATAAAATCTTGGG + Intronic
1040793928 8:51268855-51268877 CCAGCAGAACATAATGTCTTGGG + Intergenic
1045288047 8:100809073-100809095 TTAGCAATACATAAGTGCTTGGG - Intergenic
1047303106 8:123631811-123631833 CCAGCAGTGTATGAGAGTTTTGG - Intergenic
1048043332 8:130751225-130751247 CCAGTACTACATAGAAGCTTTGG - Intergenic
1049118730 8:140714406-140714428 CCAGCAGCTCAAGAGAGCTTGGG + Intronic
1056318340 9:85413560-85413582 CCAGCAGTATATAAGAGATCTGG + Intergenic
1060677015 9:125524245-125524267 CCACCAATTCATAAGACCTTTGG + Intronic
1186001516 X:5017285-5017307 TCAGCATGGCATAAGAGCTTCGG - Intergenic
1186173863 X:6904782-6904804 CCAGCAGTACAGAAGCCCTGTGG + Intergenic
1191588293 X:62852558-62852580 CCAGCAGAGCATAAGGTCTTGGG - Intergenic
1192197567 X:69038735-69038757 CCAGCAGTGCATGAGAGTTTTGG + Intergenic
1194440476 X:93927315-93927337 CCAGCAGTAAATTAGAGTTACGG + Intergenic
1195765558 X:108293119-108293141 CCAGCAGTACTTTAGTGTTTTGG + Intronic
1198169005 X:134086734-134086756 ACAGAAGTACAAAAGATCTTTGG + Intergenic
1199429619 X:147744274-147744296 TCAGCAGTATAGAACAGCTTTGG + Intergenic