ID: 1086659155

View in Genome Browser
Species Human (GRCh38)
Location 11:89393119-89393141
Sequence AAAAGGCATCTGGCTACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086659155 Original CRISPR AAAAGGCATCTGGCTACATT TGG Intronic
903845402 1:26276999-26277021 AAAAAGCATCTGGGGACAGTGGG - Intronic
906613628 1:47220226-47220248 CAAAGGCATCTCCATACATTGGG + Intronic
908290305 1:62659110-62659132 AAAAGGTATCTGGAAATATTAGG + Intronic
908606903 1:65807953-65807975 GAAAGGCATCCAGCTACTTTGGG - Intronic
910119924 1:83776234-83776256 AAAATGCAGCTGGCTTCAGTAGG + Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
917270407 1:173266565-173266587 GAAAGGCATCTAGCTCAATTTGG - Intergenic
918399166 1:184146321-184146343 TAGAGGCATCTGGCCACCTTGGG + Intergenic
918689433 1:187462279-187462301 AAAAAGAATCTGGATAAATTCGG + Intergenic
919260689 1:195190370-195190392 AAAAGAAGTCTGGCCACATTTGG - Intergenic
921383456 1:214548115-214548137 AAAATGGATCTGGTAACATTTGG - Intronic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
922463585 1:225830847-225830869 AACAGGTAGCAGGCTACATTTGG - Intronic
922610267 1:226921631-226921653 AAAAGGAATCTGGCCACAACAGG - Intronic
924330287 1:242934620-242934642 AAAACGCCTCTGGCTAAAGTTGG + Intergenic
1063622594 10:7662700-7662722 AAATGGCATATGGCTGCTTTGGG + Intronic
1063638974 10:7812895-7812917 AAAAGGCATTTGGGGACAATGGG + Intergenic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1065996050 10:31060381-31060403 AAAAAGCATCTGACCATATTCGG - Intergenic
1066223923 10:33363773-33363795 AAAAGCCCTATGGCTACATTTGG + Intergenic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1069451225 10:68519547-68519569 AATATGCATTTGGATACATTTGG + Intronic
1070126363 10:73625605-73625627 TAAAGGGACCAGGCTACATTGGG - Exonic
1070558465 10:77547833-77547855 AATAGGCATCGGGCTGGATTGGG - Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1071714314 10:88079717-88079739 AAAAGGCATATGGATACAGTGGG + Intergenic
1072792708 10:98329910-98329932 AAGATGCATTTGGGTACATTTGG - Intergenic
1075928535 10:126273312-126273334 AAAAGGCATTTGGCTCCTTCAGG - Intronic
1076110240 10:127854715-127854737 AAGAGGCAGTTGGCTAGATTTGG + Intergenic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1079310257 11:19359331-19359353 AAAAGGCATGTCTCTACAGTGGG - Intronic
1080479365 11:32630291-32630313 AACAGGCAGCAGGCTGCATTTGG - Intronic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1087357291 11:97110719-97110741 AACAGGCATCTGACTGGATTTGG - Intergenic
1088198844 11:107307516-107307538 AAAAGGCATATGGCAAAACTTGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093513072 12:19951158-19951180 CAAAGGCAACTGGGTACTTTTGG - Intergenic
1094143255 12:27202363-27202385 AAAAGGCATTTTGGTCCATTTGG - Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1096839864 12:54373652-54373674 AAAAGGCATCTCTCTGGATTTGG + Intronic
1097560108 12:61192854-61192876 AAAAAGCATATGGCTACATAGGG - Intergenic
1097614576 12:61868522-61868544 AAAAGGAATCAGGCTACATCAGG - Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1099333142 12:81317521-81317543 AAAATGCAATTGACTACATTTGG + Intronic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1103056745 12:117827267-117827289 AAAGGGGATCTGGCTGCATTTGG - Intronic
1103708082 12:122890276-122890298 AAAAGCTCTCTGGCTACATTAGG - Intronic
1103729151 12:123014415-123014437 AAGAGGCAACTGGGCACATTGGG + Intronic
1103997086 12:124837341-124837363 AATAGGCATCAGGCTGGATTTGG - Intronic
1104418349 12:128614387-128614409 AATAGGCAGCTGGCTGCATTTGG + Intronic
1105379920 13:19877404-19877426 AAAAGGAGTCTGGCTTCATTGGG - Intergenic
1108088945 13:46825371-46825393 GAAAGGCATCTGGCCATATCTGG + Intergenic
1110142429 13:72147324-72147346 AAAAGGCATCTGTGGACATTAGG - Intergenic
1111336189 13:86826954-86826976 AAAAGGCAAACTGCTACATTAGG + Intergenic
1112719436 13:102226237-102226259 AAAAGTCAGATGGCTACCTTAGG - Intronic
1115322493 14:32098733-32098755 AAAAGGCAGCAGGCTGGATTTGG + Intronic
1115337707 14:32258473-32258495 AAAAGGCAGCTGGCTTCAACTGG - Intergenic
1117125994 14:52626419-52626441 AAAAGGCATTTGACTAAATTTGG + Intronic
1117665104 14:58048313-58048335 TAAAGGCATCAAGCTACATCTGG + Intronic
1118243158 14:64081401-64081423 AAAAGGCATCTGACTAAGTTTGG + Intronic
1125238681 15:37548329-37548351 TAAAGGCATATGGCTACATGAGG - Intergenic
1126334992 15:47577417-47577439 AAAAGGCACATGGCTGCATGAGG + Intronic
1126534772 15:49749549-49749571 ACAAGGCAGATGGCTACATGGGG - Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128788118 15:70413193-70413215 AAAGGGCACCTGGAAACATTGGG + Intergenic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1131046355 15:89318913-89318935 AAGAGGTATCTTGCTACCTTTGG - Exonic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1134858064 16:17537217-17537239 AATAGGATTCTGGATACATTTGG - Intergenic
1135830900 16:25772104-25772126 ACAAGGCAGCAGGCTAGATTTGG + Intronic
1137748613 16:50841845-50841867 GAAGGGATTCTGGCTACATTAGG - Intergenic
1138725337 16:59131762-59131784 AAAACGCATCTGACAAGATTCGG - Intergenic
1138814474 16:60188421-60188443 AATAGGCTGCTGGCTACATCTGG + Intergenic
1139010399 16:62625204-62625226 AAAAGGTATCTGCCTATGTTTGG - Intergenic
1141061747 16:80879267-80879289 AAAAGCCATCATGCTACATTAGG + Intergenic
1148192365 17:45688547-45688569 AAAAGCCATTCTGCTACATTGGG - Intergenic
1149201083 17:54186630-54186652 AAAAGGCATCAGGCTAGAGCAGG - Intergenic
1149316256 17:55441619-55441641 AAAAGGCAGCTGGCTGGCTTTGG - Intergenic
1149504321 17:57181358-57181380 AAAATGCATCTGGCTACATGTGG - Intergenic
1151281151 17:73075061-73075083 AAAAGACATCTGGATGAATTTGG - Intronic
1155063598 18:22250105-22250127 ATAAGGCATCTGTATACATATGG - Intergenic
1155073224 18:22334378-22334400 AAAAGACATGTGGCTCAATTTGG + Intergenic
1155896435 18:31333830-31333852 AAAAAGTATGTGTCTACATTTGG - Intronic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1164772558 19:30821614-30821636 AAAATGCATGTGGCTCCATTTGG + Intergenic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1166651965 19:44581551-44581573 AAAAGCCATGTGGCTATCTTGGG - Intergenic
1167820905 19:51926994-51927016 AAAACGCATCTAGCTACATGTGG - Intronic
1168398809 19:56071237-56071259 AACAGGCGGCTGGCTCCATTTGG + Intergenic
925438044 2:3858395-3858417 AATAGGCAGCTGGCTTTATTTGG + Intergenic
926910860 2:17851481-17851503 AAAAAGCATCTGGCAAATTTGGG + Intergenic
926968340 2:18440752-18440774 AAAAGTCATCTGGCTCCACTCGG - Intergenic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928405768 2:31013537-31013559 AAAATGCTTCTGGTCACATTTGG - Intronic
929352725 2:40979109-40979131 AATAGGCATCTGACAACATTCGG - Intergenic
931262092 2:60629300-60629322 AGTGGGCATCTGTCTACATTTGG + Intergenic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933352563 2:81173397-81173419 AAAAGGAATTTGAGTACATTTGG - Intergenic
934196715 2:89843150-89843172 AAAAGGAATCTTCCTACTTTGGG - Intergenic
935813870 2:106828067-106828089 AAAAGGAAGCTGGCTATATATGG + Intronic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
937690360 2:124748708-124748730 ACCAGGCATCTGTCTTCATTGGG + Intronic
937898380 2:126996277-126996299 AGCATGCATCTAGCTACATTCGG + Intergenic
938668275 2:133562483-133562505 TAAAGGCAACTTGCTTCATTTGG - Intronic
938711449 2:133979130-133979152 AAGAAGGATCTGGCTGCATTTGG - Intergenic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939750625 2:146040875-146040897 AAAAGGTATAAGGCTAAATTAGG + Intergenic
941202554 2:162530194-162530216 AAAAGGCATTATGATACATTGGG - Intronic
941585068 2:167348267-167348289 AAAAGACATCTGGATACAACTGG - Intergenic
942336766 2:174896453-174896475 AAAAAGCATATGGTGACATTTGG + Intronic
942403698 2:175630416-175630438 AAAAGGGAAGTGCCTACATTTGG - Intergenic
943889063 2:193262521-193262543 AAAAGGCATCTCATTAGATTAGG + Intergenic
944311868 2:198242583-198242605 AAAAGGCAAATGTCTCCATTTGG - Intronic
945915939 2:215703973-215703995 AAAAGGAATCTGGTCTCATTTGG + Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170668768 20:18410513-18410535 AAAAGGCATTTAGAAACATTTGG + Intronic
1170790684 20:19506959-19506981 AGAAGGCATCTGGCAACAGGAGG - Intronic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1174734579 20:52953664-52953686 AATAGGCTTCTGGCTGGATTGGG - Intergenic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1177305665 21:19312035-19312057 ATGAGGCATCTGCTTACATTAGG - Intergenic
1178440138 21:32591940-32591962 AAATTGCATCTGGCTACACAGGG - Intronic
1179928092 21:44549682-44549704 AAACCACATCTGGCTACATCTGG + Intronic
1180247942 21:46560933-46560955 AGAGGACAGCTGGCTACATTGGG + Intronic
1183133517 22:35863738-35863760 AAACGACAGCTGGCTACACTGGG - Intronic
952268379 3:31808378-31808400 CCAAGGCAACTGGCTACATTTGG - Intronic
952887714 3:38021805-38021827 AAAAGGCCTGTGGCTTCATGAGG - Intronic
956020133 3:64925397-64925419 AAAAAGCATCTGAGAACATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
957005248 3:74937949-74937971 AAGAGGCGACTGGCTACCTTTGG + Intergenic
957291687 3:78285286-78285308 AAAAGGCTTCAGGCAACACTGGG - Intergenic
959797407 3:110447082-110447104 GAATGGCATCTGTTTACATTTGG - Intergenic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
962140762 3:132788381-132788403 ACAAGGCATTTGGCAACATAAGG + Intergenic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
964891472 3:161541137-161541159 AAAAGTCAGCTAGATACATTGGG + Intergenic
965188188 3:165492370-165492392 AAAAGCCATTTGTCTATATTAGG + Intergenic
965470846 3:169088871-169088893 GAAAGGCATCTGACCCCATTTGG + Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
972715493 4:41641894-41641916 AACTGGCTTCTGGCCACATTTGG + Intronic
973211477 4:47619885-47619907 AAAAGACATCTGGAAACATCTGG + Intronic
974449490 4:62034189-62034211 AAAAGGCAGCTGGATGAATTTGG - Intronic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
978077546 4:104551784-104551806 AAAGGCCATCTTCCTACATTAGG + Intergenic
979889230 4:126068577-126068599 AAATGGCATTAGACTACATTAGG - Intergenic
982880860 4:160713440-160713462 AAAAGGCATCTGAATTCATCAGG + Intergenic
983162185 4:164430072-164430094 ACAGAGCATCTGGCTACATAAGG - Intergenic
984239756 4:177204223-177204245 AAAAGGAATGTAGCTACATGTGG + Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
987201892 5:15585712-15585734 ACAAGGCATCAGGATTCATTAGG - Intronic
989342739 5:40394515-40394537 AAAACACATCTGTCTCCATTTGG - Intergenic
990486002 5:56259919-56259941 ATAGGGCATCTGTCTTCATTTGG + Intergenic
991098313 5:62762934-62762956 AAATGTCAGCAGGCTACATTTGG - Intergenic
991995730 5:72384758-72384780 TAAAGGCATCTGGCTTCTTGGGG - Intergenic
992258840 5:74949955-74949977 AAAAGCCATCTTTCTCCATTGGG - Intergenic
994670827 5:102759512-102759534 TCAAGGCATCTGGCAACACTTGG - Intronic
994868264 5:105308077-105308099 AAAAAGGAACAGGCTACATTAGG + Intergenic
995848515 5:116520238-116520260 AAAAAGCATCAGGCTGCTTTGGG - Intronic
995900950 5:117065742-117065764 AAGAGGCATCTGGCTGGATATGG + Intergenic
996093656 5:119375988-119376010 AAAAGTCATCTGATAACATTTGG - Intronic
998497604 5:142604134-142604156 AAAAGGCATGGGGCTTCTTTTGG + Intronic
998629177 5:143879541-143879563 AAAAGGCATCTTTCAAGATTGGG - Intergenic
1000517224 5:162252944-162252966 AAAAGGCATGAGACTTCATTGGG - Intergenic
1000718119 5:164672328-164672350 GAAAGAGATCTGGGTACATTAGG + Intergenic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1005666005 6:28056505-28056527 TAAAAACATCTGCCTACATTAGG + Intergenic
1007224630 6:40304272-40304294 AACAGGCATCGGGCTGGATTTGG + Intergenic
1008976452 6:57433021-57433043 AATAAGCAGCTGGCTATATTTGG - Intronic
1009837563 6:69023741-69023763 AAAAGCCTTCTATCTACATTTGG - Intronic
1010082550 6:71881202-71881224 AACAGTCATTTGGCTAAATTTGG + Intergenic
1010135987 6:72553596-72553618 AAAAGGCATCTCGTTACACAAGG + Intergenic
1010255546 6:73753077-73753099 AACAGGTGTCAGGCTACATTTGG - Intronic
1010743387 6:79534012-79534034 AAAAACCATATTGCTACATTTGG + Intronic
1011166317 6:84451289-84451311 AAAAGCAAACTGACTACATTTGG - Intergenic
1011703466 6:89977826-89977848 AAAAGTCATCTTGCTAAATGAGG + Intronic
1013400587 6:109792138-109792160 AAAAGGCATCAGGCTGGATTTGG - Intronic
1013515452 6:110881359-110881381 AGAAGACATGTGGCAACATTTGG - Intronic
1014590879 6:123267948-123267970 AAAAGGCTTTTTTCTACATTTGG + Intronic
1014892270 6:126856943-126856965 AAAAGGCATTTGGATAAAATGGG - Intergenic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1018824039 6:167395970-167395992 AAATTGCATCTGGCTACACAAGG - Intergenic
1019306839 7:339670-339692 AAAAGGCACCTGGTTCCATCTGG - Intergenic
1020380116 7:7534890-7534912 AAATGTCCTCTGGCTACAATAGG - Intronic
1020778929 7:12494063-12494085 AAAAGGCAACAGGCTAAATAAGG + Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1021348250 7:19554903-19554925 AACAGGCAGCTGACTAGATTTGG - Intergenic
1021868829 7:24983379-24983401 AGAAGGCATTGGGCTAAATTAGG + Intergenic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1023520298 7:41043712-41043734 AAAAGGCTACTGACTTCATTTGG - Intergenic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1026033928 7:66817487-66817509 AAAAGGCTTCGGACTGCATTTGG + Intergenic
1028194117 7:87885510-87885532 AAAAGGCAACAGACTAGATTTGG - Intronic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1030681104 7:112435080-112435102 AAAAGGCATCTTGCATCATGAGG - Intronic
1032458084 7:132088509-132088531 AAGAGGAAGCTGGCTGCATTAGG - Intergenic
1032936859 7:136742813-136742835 ACAAGCCATCTGGGTACATGTGG - Intergenic
1036530436 8:9580579-9580601 AATAGGCATTTGACTGCATTTGG - Intronic
1037311796 8:17563853-17563875 AAAAGGCATCTGAAAACATCTGG - Intronic
1038536601 8:28358054-28358076 AACAAGCAGCAGGCTACATTGGG - Intronic
1039265866 8:35823270-35823292 AACAGGTAGCTGGCTAGATTTGG + Intergenic
1042017735 8:64334977-64334999 TAAAAGCATTTGGCTACAATTGG - Intergenic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1044977962 8:97684431-97684453 AACAGGCATCTGTCTGGATTTGG - Intronic
1045500859 8:102743418-102743440 AACATGCAACTGGATACATTAGG + Intergenic
1045780141 8:105853320-105853342 AAAAAGCATCTGACAACATGCGG + Intergenic
1046228421 8:111317665-111317687 AAAAGTCATCTTTCTACATAGGG - Intergenic
1046364305 8:113205969-113205991 AAAGGGCATCAGGCCATATTTGG - Intronic
1049854007 8:144850305-144850327 CAAAAGCACCTGGCTACATGGGG + Exonic
1049981858 9:911257-911279 ACAGGGCATCTGGCAACATCTGG - Intronic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050829316 9:9990728-9990750 AAATGGCATTTGCTTACATTGGG + Intronic
1051103272 9:13547613-13547635 ACAAGGCATCTGGTAACAATGGG - Intergenic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1057581727 9:96293071-96293093 AAAAGGAATCTTGGGACATTGGG + Intronic
1057859441 9:98627997-98628019 AAAAGCCATTTAGCTACAATTGG - Intronic
1059121644 9:111644723-111644745 AAAAGGCATCTGTCATGATTGGG + Intronic
1059458906 9:114417285-114417307 AAATGGAAACTGGCTCCATTTGG + Intronic
1061736038 9:132659851-132659873 AAAAGGCAACTGCCCACACTTGG + Intronic
1188582440 X:31730640-31730662 AAAAGGCATCTGACTAGCTCTGG + Intronic
1189179487 X:38989759-38989781 AGAAGGCATCAGGCTACATGGGG + Intergenic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192836889 X:74809352-74809374 CAAAGGCAACTGTCTACTTTAGG + Intronic
1193645246 X:84060388-84060410 AAAAGGGATCTGGAAAAATTTGG + Intronic
1194676632 X:96802377-96802399 AATAGGCTTCAGGCTAGATTTGG + Intronic
1195041767 X:101021203-101021225 AAAAGGCATCTGGAGAGATGCGG + Exonic
1195251682 X:103053708-103053730 AACAGCCATCTTGTTACATTAGG + Intergenic
1197949976 X:131883664-131883686 AAAAGGAATCTGGGAACACTAGG + Intergenic
1202346118 Y:23929727-23929749 AAAAGGTTTCTGTCTAAATTCGG - Intergenic
1202524653 Y:25740363-25740385 AAAAGGTTTCTGTCTAAATTCGG + Intergenic