ID: 1086664116

View in Genome Browser
Species Human (GRCh38)
Location 11:89458210-89458232
Sequence CATTTGCAAAAGATTTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1768
Summary {0: 1, 1: 0, 2: 3, 3: 165, 4: 1599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086664116 Original CRISPR CATTTGCAAAAGATTTAATC TGG Intronic
900734423 1:4287312-4287334 CATGTGCAGAAGATTGAAACTGG - Intergenic
901358499 1:8674128-8674150 CATTTGCTATAGATTTAATTTGG - Intronic
901552663 1:10007370-10007392 CATTTGCAAACTTTTTAATCAGG + Intronic
902095156 1:13937722-13937744 CATTTACAAAAGAATAAAACTGG - Intergenic
903289694 1:22301306-22301328 CATATGCAAAAGATTAAAACTGG + Intergenic
904667015 1:32130892-32130914 CATATGCAGAAGAATTAATTTGG + Intronic
905100515 1:35517507-35517529 CATATGCAGAAGATTAAAGCTGG + Intronic
905147530 1:35899518-35899540 CACTAGCAAAAGACTAAATCAGG - Intronic
905848180 1:41252077-41252099 CATATGCAGAAGATTGAAGCTGG - Intergenic
906051078 1:42873113-42873135 CATATGCAGAAGATTGAAACTGG - Intergenic
906421509 1:45672060-45672082 CTTTTTAAAAAGATTTATTCAGG + Intronic
906441447 1:45849495-45849517 CATATGCAGAAGATTAAAGCTGG + Intronic
906585397 1:46972134-46972156 CATGTGTAGAAGATTTAAACTGG - Intergenic
906643368 1:47455321-47455343 CATTTGCCATAGCTTTAATCTGG + Intergenic
906682724 1:47741043-47741065 CATATGCAGAAGATTGAAACTGG + Intergenic
906737678 1:48147636-48147658 CATATGCAGAAGATTGAAGCTGG + Intergenic
906836704 1:49091031-49091053 CATATGCAGAAGATTGAAGCTGG + Intronic
906971929 1:50524581-50524603 CATATGCAGAAGATTGAAACCGG - Intronic
907141261 1:52187261-52187283 CATATGCAGAAGATTGAAGCTGG + Intronic
907501157 1:54882188-54882210 AATTGGCAAAAGATTTGATCAGG + Intronic
907638852 1:56164956-56164978 CATATGCAGAAGATTGAAACTGG - Intergenic
907982278 1:59495678-59495700 CATATGCAGAAGATTGAAACTGG - Intronic
908094633 1:60724136-60724158 CATATGCAGAAGATTGAAACTGG - Intergenic
908226722 1:62063201-62063223 CATTTGCAGAAGAATTAAACTGG - Intronic
908376108 1:63543134-63543156 CATCTGCAAAAGAATAAATTTGG - Intronic
908377958 1:63565007-63565029 CATATGCAGAAGATTGAAACTGG + Intronic
908867131 1:68561642-68561664 CATTTGCAGAAGAATGAAACAGG - Intergenic
909025204 1:70473747-70473769 CATATGCAGAAGATTGAAACTGG + Intergenic
909053349 1:70794545-70794567 CATATGCAAAAGAATGAAACTGG + Intergenic
909210757 1:72819706-72819728 CATATGCAGAAGATTGAAGCTGG + Intergenic
909267525 1:73579624-73579646 CATTCTCCCAAGATTTAATCAGG + Intergenic
909431894 1:75597735-75597757 CATATGCAGAAGATTGAAACTGG + Intronic
909656883 1:78042728-78042750 AATCTGCAAAAGATTTGATAGGG - Intronic
909659455 1:78065839-78065861 CATATGCAGAAGATTAAAGCTGG + Intronic
909689407 1:78390228-78390250 CATATGCAGAAGATTGAAACTGG - Intronic
909695211 1:78460682-78460704 CATATGCAGAAGATTGAAGCTGG - Intronic
909805608 1:79871112-79871134 CAATTGCTAAAGATATAATTTGG + Intergenic
909806650 1:79881084-79881106 CATATGCAGAAGATTGAAACTGG + Intergenic
909824521 1:80110729-80110751 CATATGCAAAAGAATAAAACTGG - Intergenic
909898581 1:81105589-81105611 CATATGCAGAAGATTGAAACTGG - Intergenic
910166432 1:84332925-84332947 CATATGCAGAAGATTGAAACTGG - Intronic
910203960 1:84728799-84728821 CATATGCAAAAGATTGAAACTGG - Intergenic
910313376 1:85854160-85854182 CATATGCAGAAGATTGAAGCTGG - Intronic
910453995 1:87375900-87375922 CATATGCAAAAGATTGAAATTGG - Intergenic
910512623 1:88023583-88023605 CATATGCAGAAGATTCAAACTGG - Intergenic
910614602 1:89183345-89183367 CATATGCAGAAGATTGAAACTGG + Exonic
911017466 1:93348424-93348446 AAATTGCAAAAGATTTCAGCAGG + Intronic
911117585 1:94262201-94262223 CATATGCAGAAGATTGAAACTGG + Intronic
911374807 1:97039127-97039149 CATATGCAGAAGATTGAAACTGG - Intergenic
911514252 1:98847609-98847631 CATATGCAGAAGATTGAAACTGG - Intergenic
911595642 1:99795790-99795812 CATATGCAAAAAATTGAAACTGG - Intergenic
911744362 1:101423867-101423889 CATATGCAAAAGAATGAATTTGG + Intergenic
911892162 1:103385227-103385249 CATATGCAAAATATTGAAGCTGG - Intergenic
911932303 1:103920541-103920563 CATATGCAGAAGATTGAAACTGG - Intergenic
911976520 1:104503465-104503487 CATTGACAAAAGAATTAATTTGG + Intergenic
912038231 1:105349689-105349711 CATATGCAGAAGATTGAATCTGG + Intergenic
912085474 1:105997234-105997256 AATTTGAAAAAGATCTAATTGGG - Intergenic
912151980 1:106870717-106870739 CATATGCAGAAGATTGAAACTGG - Intergenic
912188392 1:107308348-107308370 CATATGCAGAAGATTGAAACTGG - Intronic
912220624 1:107670444-107670466 CATTTGCAAAGGTTTTAATTTGG - Intronic
912279644 1:108299450-108299472 CATGTGCAGAAGATTGAAACTGG - Intergenic
912288582 1:108394907-108394929 CATGTGCAGAAGATTGAAACTGG + Intronic
912303286 1:108538718-108538740 CATATGCAGAAGAGTGAATCTGG - Intergenic
912595169 1:110868509-110868531 CATATGCAGAAGATTGAAACTGG + Intergenic
912611399 1:111048854-111048876 CATATGTAAAAGATTGAAACTGG - Intergenic
912647649 1:111410061-111410083 CATATGCAGAAGATTGAAACTGG + Intergenic
912656950 1:111494940-111494962 CATATGCAGAAGATTGAAACTGG + Intronic
912665349 1:111574153-111574175 CATATGCAGAAGATTGAAACTGG - Intronic
912884996 1:113461518-113461540 CATATGCAGAAGATTGAAGCTGG + Intronic
913048898 1:115098219-115098241 CATATGCAGAAGATTAAAACTGG + Intergenic
913083752 1:115414674-115414696 CATATGCAGAAGATTGAAACTGG - Intergenic
913336267 1:117711260-117711282 CATTTGGAAAAAATTTAATCTGG - Intergenic
913411172 1:118553587-118553609 CATATGCAGAAGATTGAAGCTGG + Intergenic
913572687 1:120136767-120136789 CACATGCAAAAGAATTAATTTGG + Intergenic
913573829 1:120149088-120149110 CATATGCATAAGATTGAAACTGG - Intergenic
913590324 1:120318469-120318491 CATATGCAAAAGAATGAAACTGG + Intergenic
913617862 1:120579894-120579916 CATATGCAAAAGAATGAAACTGG - Intergenic
914295090 1:146313890-146313912 CATATGCATAAGATTGAAACTGG - Intergenic
914556131 1:148764673-148764695 CATATGCATAAGATTGAAACTGG - Intergenic
914572410 1:148931078-148931100 CATATGCAAAAGAATGAAACTGG + Intronic
914600429 1:149199181-149199203 CATATGCAAAAGAATGAAACTGG - Intergenic
914616703 1:149365558-149365580 CATATGCATAAGATTGAAACTGG + Intergenic
914693437 1:150052982-150053004 CATATGCAGAAGATTGAAACTGG + Intergenic
914697706 1:150100774-150100796 CATATGCAGAAGATTGAAGCTGG + Intronic
914842137 1:151257136-151257158 CATATGCAGAAGATTGAAGCTGG - Intronic
914994329 1:152528448-152528470 CATATGCAAAAGATTAAAATGGG - Intronic
915049551 1:153053676-153053698 CATATGCAGAAGATTGAAACTGG + Intergenic
915052515 1:153090454-153090476 CATATGCAGAAGATTGAAACTGG + Intergenic
915816161 1:158967888-158967910 CATATGCAGAAGATTAAAACTGG + Intronic
915989384 1:160498203-160498225 CATATGCAGAAGATTGAAACTGG - Intronic
915989480 1:160499256-160499278 CATATGCAGAAGATTGAAACTGG - Intronic
916032698 1:160892154-160892176 CATATGCAAAAGATTAAAACTGG + Intergenic
916151617 1:161798105-161798127 CATATGCAGAAGATTGAAACTGG + Intronic
916245161 1:162680330-162680352 CATATGCAGAAGATTGAAACTGG - Intronic
916363942 1:164002405-164002427 CATCTGCAGAAGATTGAAACTGG + Intergenic
916392901 1:164351022-164351044 CATATGCAGAAGATTAAAACTGG + Intergenic
916637312 1:166686731-166686753 CATATGGAGAAGATTTAAACTGG - Intergenic
916979601 1:170119070-170119092 CATATGCAGAAGATTGAAACTGG + Intergenic
917142972 1:171856063-171856085 CATATGCAGAAGATTGAAGCTGG - Intronic
917181260 1:172300607-172300629 CATATGCAAAAGAATGAAACTGG + Intronic
917228414 1:172809211-172809233 CATATGCAAAAAATTGAAACTGG - Intergenic
917236264 1:172895123-172895145 AATTTGCAAAGAATTTGATCAGG - Intergenic
917251403 1:173065795-173065817 CATATGCAGAAGATTGAAACTGG + Intergenic
917253645 1:173090400-173090422 CATATACAAAAGATTGAAACTGG - Intergenic
917377277 1:174362983-174363005 CATATGCAGAAGATTAAAACTGG - Intronic
917407985 1:174729271-174729293 CATATGCAAAAGAATGAAACTGG + Intronic
917416340 1:174814216-174814238 CATGTCCAAAAAATTTATTCTGG - Intronic
917528614 1:175812254-175812276 CATATGCAGAAGATTGAAACTGG + Intergenic
917585298 1:176420372-176420394 CATATGCAGAAGATTGAAACTGG - Intergenic
918137198 1:181684674-181684696 CATATGCAAAAGATTGAAACTGG - Intronic
918380489 1:183949523-183949545 CATGTGCAAAAGAATGAATATGG + Intronic
918516013 1:185364202-185364224 CATATGCAGAAGATTGAATCTGG + Intergenic
918629356 1:186697422-186697444 CATTTGCAGAAGATTGAAGCTGG + Intergenic
918830553 1:189391783-189391805 CATATGCAGAAGATTGAAGCTGG + Intergenic
918854026 1:189727736-189727758 CATACGCAAAAGATTGAAACTGG - Intergenic
918858840 1:189795117-189795139 CATATGCAGAAGATTGAAACTGG - Intergenic
918867711 1:189924863-189924885 CATATGCAGAAGATTGAAACTGG + Intergenic
918930268 1:190846491-190846513 CATATGCAGAAGATTGAAGCTGG + Intergenic
918930734 1:190853328-190853350 CATATGCAAAAGATTGAAGCTGG - Intergenic
918937077 1:190934816-190934838 GATTTCCAAAAGATTAAATATGG - Intergenic
919015304 1:192025947-192025969 CATATGCAGAAGATTGAAACTGG - Intergenic
919195324 1:194277580-194277602 CATAAGCAAAAGATTGAAACTGG + Intergenic
919203725 1:194393083-194393105 CATATGCAGAAGATTGAAACTGG + Intergenic
919222008 1:194641577-194641599 CATATGCAGAAGATTGAATCTGG - Intergenic
919242139 1:194927868-194927890 CAATTGCAATGTATTTAATCAGG + Intergenic
919302520 1:195789060-195789082 CATATGCAAACGATTGAAACTGG - Intergenic
919355862 1:196520742-196520764 CATATGCAGAAGATTGAAACTGG + Intronic
919533856 1:198761573-198761595 CATATGCAGAAGATTAAAACTGG + Intergenic
919995394 1:202743787-202743809 CATATGCAGAAGATTAAAACTGG + Intronic
920204049 1:204278706-204278728 CTTTTGCAAATGATTTATCCTGG + Intronic
920643585 1:207778482-207778504 CATATGCAGAAGATTGAAACTGG - Intronic
920752743 1:208695906-208695928 CATTTGTAAAATATTTATTCTGG - Intergenic
920923755 1:210322059-210322081 CATATGCAAAAGATTGAAGCTGG + Intergenic
921012448 1:211155852-211155874 CATATGCAGAAGATTGAACCTGG - Intergenic
921147281 1:212370164-212370186 CATTTACAAAACATTTCATCTGG + Intronic
921331957 1:214048268-214048290 CATATGCAGAAGATTGAAACTGG + Intergenic
921336284 1:214090027-214090049 CATATGCAGAAGATTGAAGCTGG - Intergenic
921540587 1:216409673-216409695 CATATGCAGAAGATTGAAACTGG + Intronic
921674828 1:217965695-217965717 CATTTGCAGAAGATTGAAACTGG + Intergenic
921675073 1:217968066-217968088 CATTTGCAGAGGATTGAAACTGG - Intergenic
921787701 1:219251473-219251495 CATATGCAGAAGATTGAAGCTGG - Intergenic
921961339 1:221037892-221037914 CATATGCAGAAGATTGAAACTGG - Intergenic
921963237 1:221058524-221058546 CATATGCAAAAGAATGAAACTGG - Intergenic
921990806 1:221364611-221364633 CATATGCAAAAGATTGAAACTGG + Intergenic
922148258 1:222971129-222971151 CATTGTCAAAAGCTTTAATAAGG - Intronic
922381510 1:225033274-225033296 CATATGCAGAAGATTGAAGCTGG - Intronic
922386817 1:225094421-225094443 CATATGCAGAAGATTGAAACTGG + Intronic
922515294 1:226203474-226203496 CATTTGCAGCAGATGTATTCAGG - Intergenic
922681455 1:227600967-227600989 CATATGCAGAAGATTGAAACGGG - Intronic
922971364 1:229743193-229743215 CATATGCAGAAGATTCAAACTGG - Intergenic
923179711 1:231504490-231504512 CATATGCAGAAGATTGAATCTGG - Intergenic
923191438 1:231624387-231624409 CATATGCAGAAGATTGAAACTGG + Intronic
923247199 1:232144031-232144053 AATTTGGAAAATATTTAATAAGG + Intergenic
924109094 1:240680262-240680284 CATATGCAGAAAATTGAATCTGG + Intergenic
924171943 1:241351498-241351520 CATATGTGAAAGATTTATTCAGG + Intronic
924819547 1:247475541-247475563 CATATGCAGAAGATTGAAACTGG + Intergenic
924919007 1:248606417-248606439 CATATGCAAAAGATTAGAACTGG - Intergenic
1062775783 10:146312-146334 CCTATGCAAAAGAACTAATCTGG - Intronic
1063061571 10:2560758-2560780 CTTTTAAAAAAGATTTCATCGGG - Intergenic
1063313167 10:4975636-4975658 CAGTTTCAAAATATTTTATCTGG + Intronic
1063314789 10:4992106-4992128 CAGTTTCAAAATATTTTATCTGG - Intronic
1063322536 10:5064325-5064347 CATGTGCAGAAGATTGAAACGGG + Intronic
1063699124 10:8367340-8367362 CATATGCAAAAAATTGAAACTGG + Intergenic
1064313358 10:14232126-14232148 CATATGCAGAAGATTGAAACTGG - Intronic
1064801581 10:19080562-19080584 CATATGCAAAAAATTGAAACTGG + Intronic
1064845687 10:19649922-19649944 CATATGCAGAAGATTGAAGCTGG - Intronic
1065059741 10:21887681-21887703 CATATGCAGAAGATTGAAACTGG + Intronic
1065592234 10:27275938-27275960 CATATGCAGAAGATTGAAACTGG + Intergenic
1065654191 10:27930226-27930248 GTTTTGCAAAAGATTTTATAAGG - Intronic
1065658122 10:27974424-27974446 CATATGCAGAAGATTGAAACTGG - Intronic
1066173266 10:32875330-32875352 CATATGCAGAAGATTGAAACTGG - Intronic
1066522780 10:36241235-36241257 CATATGCAGAAGATTGAAACTGG - Intergenic
1067005574 10:42657833-42657855 CATATGCAGAAGATTGAAGCTGG + Intergenic
1067106531 10:43370688-43370710 CATTTGGAAAAGAATTAAGGAGG + Intergenic
1067731520 10:48815372-48815394 AACTGGCAAAAGATATAATCAGG - Intronic
1067924389 10:50493261-50493283 CATATGCAGAAGATTGAAACCGG + Intronic
1068291851 10:55013295-55013317 CATTTTCAAAAGATTTTTTCAGG - Intronic
1068294695 10:55054838-55054860 CATTTGCCCAATATTTAATAGGG + Intronic
1068294720 10:55055208-55055230 CATATGCAAAAGATTGAGACTGG - Intronic
1068492976 10:57747286-57747308 CATATGCAGAAGATTGAAACTGG - Intergenic
1068648030 10:59491633-59491655 AATTTAAAAAAGATTGAATCAGG - Intergenic
1068890464 10:62143354-62143376 CATATGCAGAAGATTGAAACTGG + Intergenic
1068891438 10:62152211-62152233 CATATGCAGAAGATTGAAACCGG - Intergenic
1068906091 10:62324495-62324517 CATATGCAAAAGATTGAAACTGG + Intergenic
1069130617 10:64697544-64697566 CATATGCAAAAGAATGAAACTGG + Intergenic
1069150723 10:64955635-64955657 CATATGCAGAAGATTGAAACTGG + Intergenic
1069167276 10:65177556-65177578 CATATGCAGAAGATTAAAACTGG - Intergenic
1069169144 10:65203243-65203265 CAATAGCAAAACATTAAATCAGG + Intergenic
1069207008 10:65702254-65702276 CATTTGCAGAAGAATAAAGCTGG + Intergenic
1069233357 10:66039674-66039696 CATGTGCAGAAGATTGAAACTGG + Intronic
1069296872 10:66857101-66857123 CATATGCAGAAGATTGAAACTGG - Intronic
1069320153 10:67159666-67159688 CATATACAAAAGAATTAATTTGG + Intronic
1069344300 10:67449604-67449626 CATATGCTAAAGATTGAAACTGG + Intronic
1070363275 10:75711830-75711852 CATTTGCAAAACATTTCACGGGG - Intronic
1070413536 10:76167450-76167472 CATATGCCAAAGATTGAAACTGG - Intronic
1070857945 10:79622774-79622796 CATATGCAGAAGATTGAAACTGG + Intergenic
1070871034 10:79753221-79753243 CACATGCAAAAGATTGAAGCTGG + Intergenic
1071022707 10:81077602-81077624 CATATGCAGAAGATTGAACCTGG - Intergenic
1071095875 10:81974104-81974126 CATATGCACAAGATTAAAACTGG - Intronic
1071192157 10:83113726-83113748 CATATGCAGAAGATTGAAGCTGG + Intergenic
1071209739 10:83325938-83325960 CATATGCAAAAGAATTAAGTTGG - Intergenic
1071410459 10:85387130-85387152 CATATGCAGAAGATTGAAGCTGG + Intergenic
1071534193 10:86414170-86414192 AATTTAAAAAAGATTTAATCAGG - Intergenic
1071637964 10:87275434-87275456 CACATGCAAAAGATTGAAGCTGG + Intergenic
1071736617 10:88308072-88308094 CATATGCAGAAGATTGAAACTGG + Intronic
1071772885 10:88749557-88749579 CATATGCAGAAGATTGAAACTGG + Intronic
1071999503 10:91180534-91180556 CATATGCAGAAGATTGAAACTGG - Intronic
1072203865 10:93185146-93185168 CATATGCAGAAGATTGAAACTGG - Intergenic
1072832017 10:98668701-98668723 CATATGCAAAATAATGAATCTGG + Intronic
1073202107 10:101744050-101744072 GATTTGCATAATATTTTATCTGG + Intergenic
1073389332 10:103160187-103160209 CATGTGCAAAAAAATGAATCTGG + Intronic
1073694251 10:105847377-105847399 CATATGCATAAGATTGAAACTGG - Intergenic
1073784211 10:106870632-106870654 CATATGCAGAAGATTGAAGCTGG + Intronic
1073813946 10:107184715-107184737 CATATGCAAAATATTGAAACTGG + Intergenic
1073863637 10:107775516-107775538 CGTATGCAAAAGATTAAAACTGG + Intergenic
1073880790 10:107977315-107977337 CATATGCAGAAGATTGAAACTGG - Intergenic
1073902282 10:108236552-108236574 CATTTGCAAAATACTGAATACGG - Intergenic
1074072954 10:110091580-110091602 CATATGCAGAAGATTGAAACTGG + Intronic
1074469981 10:113718182-113718204 CATATGCAAAAGAATGAAACTGG - Intronic
1074628872 10:115226872-115226894 CATATGCCAAAGATTGAAGCTGG + Intronic
1074645841 10:115451064-115451086 CATATGCAGAAGATTGAAGCTGG + Intronic
1075186001 10:120257944-120257966 CATATGCAGAAGATTGAAACTGG - Intergenic
1075187973 10:120280255-120280277 CATATGCAGAAGATTAAAACTGG + Intergenic
1075628422 10:123982917-123982939 CATATGCAGAAGATTGAAACTGG + Intergenic
1076074182 10:127519865-127519887 CATATGCAGAAGATTGAAACTGG + Intergenic
1076101541 10:127783897-127783919 CATATGCAGAAGATTGAAACTGG + Intergenic
1077620487 11:3717917-3717939 CATGGCCAAAAGATTTATTCTGG - Intronic
1077734498 11:4774824-4774846 CATTTGCAAAAAATTGAAACTGG - Intronic
1077765738 11:5158208-5158230 CATTTGCAAAAGAGTAAAATCGG - Intronic
1077812481 11:5652362-5652384 CATATGCAGAAGATTGAAACTGG - Intergenic
1078027887 11:7715647-7715669 CATGTGCAGAAGATTAAAACTGG - Intergenic
1078113331 11:8419278-8419300 CATATGCAGAAGATTAAAACTGG - Intronic
1078120377 11:8502426-8502448 CATATGCAGAAGATTAAAACTGG + Intronic
1078285119 11:9945391-9945413 CATTTGCAGAATATTGAAACTGG + Intronic
1078530455 11:12132789-12132811 CATTTGCTAGAGAATTAAACTGG - Intronic
1078647569 11:13155725-13155747 CATATGCAAAAGATTGAAACTGG - Intergenic
1078694358 11:13615510-13615532 CATATGCAGAAGATTGAAACTGG - Intergenic
1078755722 11:14207180-14207202 CATATGCAGAAGATTGAAACTGG + Intronic
1079255372 11:18823439-18823461 CATATGCAGAAGATTGAAACTGG - Intergenic
1079277104 11:19051130-19051152 CATATGCAGAAGATTGAAGCTGG + Intergenic
1079306180 11:19325113-19325135 CATGTGCAGGAGATTGAATCTGG + Intergenic
1079555643 11:21755439-21755461 CATATGCAGAAGATTGAAACTGG - Intergenic
1079621739 11:22564039-22564061 CATATGCAGAAGATTGAAGCTGG - Intergenic
1079667822 11:23130059-23130081 CATATGCAGAAGATTAAAACTGG - Intergenic
1079693581 11:23450885-23450907 CATATGCAGAAGATTGAAACTGG + Intergenic
1079700181 11:23536379-23536401 CATATGCAAAAGAATAAAACTGG - Intergenic
1079703005 11:23572733-23572755 CATATGCAGAAGATTGAAACTGG - Intergenic
1079731970 11:23944314-23944336 CATTTGAAAAATATTGAATTAGG + Intergenic
1079777100 11:24545475-24545497 CATATGCAGAAGATTGAAGCTGG - Intronic
1079777265 11:24547512-24547534 CATATGCAAAAGATTGAAATAGG + Intronic
1079877038 11:25871914-25871936 CATATGCAGAAGATTAAAACTGG - Intergenic
1079958321 11:26891143-26891165 CATATGCAAAAGATTGAAACTGG + Intergenic
1079992434 11:27260459-27260481 CATATGCAGAAGATTGAAACTGG + Intergenic
1080150164 11:29043365-29043387 CATATGCAGAAGATTGAAGCTGG + Intergenic
1080256941 11:30300858-30300880 CATATGCAGAAGATTTAAATTGG + Intergenic
1081026734 11:38024072-38024094 CATATGCAGAAGATTGAAACTGG + Intergenic
1081084051 11:38777007-38777029 CATATGCAGAAGATTGAAACTGG + Intergenic
1081096858 11:38946922-38946944 CATATGCTGAAGATTTAAGCTGG + Intergenic
1081194827 11:40148877-40148899 CATATGCAAAAGATTCAAACTGG - Intronic
1081211858 11:40345493-40345515 CATATGCAGAAGATTGAAACTGG + Intronic
1081228406 11:40554136-40554158 CATATGCAAAAGATTGAAATTGG - Intronic
1081341346 11:41931810-41931832 AAATTGCAAAAGATTCACTCAGG + Intergenic
1081837754 11:46171103-46171125 AATGAGCAAAAGATTTAAACAGG + Intergenic
1082223619 11:49673583-49673605 CATTTGCAAAAGAATGAAACTGG - Intergenic
1082254377 11:50016526-50016548 TATTTGCAAAAGAATTAATGGGG - Intergenic
1082612316 11:55315717-55315739 CATTTTCAAAAGATAAAATTTGG - Intergenic
1082676741 11:56114202-56114224 CATATGCAGAAGATTGAAACTGG + Intergenic
1082677826 11:56130239-56130261 CATATGCAGAAGATTGAAACTGG + Intergenic
1082688236 11:56266956-56266978 CATATGCAGAAGATTGAAACTGG + Intergenic
1082733623 11:56830725-56830747 CATTTACAAAAGAATGAAACAGG + Intergenic
1082900647 11:58247035-58247057 CATATGCAGAAGATTGAAACTGG + Intergenic
1083495156 11:63045493-63045515 CATATGCAGAAGATTGAAACTGG + Intergenic
1084843839 11:71883535-71883557 CATATGCAAAAGAATAAAACTGG + Intronic
1085158684 11:74320929-74320951 TATTTGCAACAGAATTATTCAGG + Intergenic
1085169139 11:74433478-74433500 AATTTTCAAAAGACTTAAACAGG + Intergenic
1085571589 11:77562955-77562977 CATATGCAAAAGAATGAAACTGG - Intronic
1085888513 11:80549512-80549534 CATTTGCACAAAATTGAAACTGG + Intergenic
1085930808 11:81081109-81081131 CATATGCAAAAGAATTAAACTGG - Intergenic
1085955853 11:81393785-81393807 CATCTGAAAAAGTTTTAATAAGG + Intergenic
1085965922 11:81526316-81526338 CATATGCAGAAGATTTAAGCTGG - Intergenic
1086029970 11:82342874-82342896 CATAGGCAAAAGATTGAAGCTGG + Intergenic
1086076128 11:82854966-82854988 CATATGCAGAAGATTGAAACTGG + Intronic
1086137565 11:83457211-83457233 CATTTGCACCAGATGTAATCTGG + Intronic
1086413234 11:86563645-86563667 CATATGCAAAAGATTAAAACTGG - Intronic
1086510388 11:87551185-87551207 CATATGCAAAAGATTGAAACTGG - Intergenic
1086526484 11:87733287-87733309 CATATGCAGAAGATTGAAACTGG - Intergenic
1086563287 11:88193936-88193958 CATATGCAGAAGATTAAAACTGG - Intergenic
1086625441 11:88945681-88945703 CATATGCAAAAGAATGAAACTGG + Intronic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1086740391 11:90361023-90361045 CATATGCAAAAGACTAAAACTGG - Intergenic
1086751201 11:90496003-90496025 CATATGCAGAAGATTCAAGCTGG - Intergenic
1086760455 11:90624033-90624055 CACATGCAGAAGATTGAATCTGG + Intergenic
1086777446 11:90857291-90857313 CATATGCAGAAGATTGAAACCGG - Intergenic
1086994972 11:93346052-93346074 CATATGCAGAAGATTGAAACTGG - Intronic
1087337170 11:96859055-96859077 CATATGCAGAAGATTGAAACTGG - Intergenic
1087590998 11:100187733-100187755 CATATGCAAAAGAATGAAACTGG + Intronic
1087597729 11:100274166-100274188 CATATGCAGAAGATTGAAACTGG + Intronic
1087620200 11:100532065-100532087 CATATGCAGAAGATTGAAACTGG + Intergenic
1087749778 11:101994565-101994587 CATGTGCAGAAGATTGAAGCTGG - Intronic
1087815267 11:102651481-102651503 CATATGCAGAAGATTGAAACTGG - Intergenic
1087931514 11:103983364-103983386 CATATGCAGAAGATTGAAACTGG + Intronic
1088033807 11:105286723-105286745 CATTTGCAAACTATTCAAACAGG + Intergenic
1088052127 11:105529777-105529799 CATATGCAGAAGATTGAAACTGG + Intergenic
1088099332 11:106137607-106137629 CATATGCAGAAGATTAAAACTGG + Intergenic
1088185913 11:107169619-107169641 CATATGCAGAAGATTAAAACTGG - Intergenic
1088420445 11:109639345-109639367 CATATGCAGAAGATTAAAACTGG - Intergenic
1088806114 11:113353659-113353681 CATATGCAGAAGATTGAAACTGG - Intronic
1088945542 11:114508687-114508709 CATATGCAGAAGATTGAAACTGG + Intergenic
1089594067 11:119565046-119565068 CATATGCAGAAGATTGAAACTGG + Intergenic
1090096720 11:123749422-123749444 CATATGCAGAAGATTGAAACTGG - Intergenic
1090114839 11:123957804-123957826 CATATGCAGAAGATTAAAACCGG - Intergenic
1090162170 11:124507069-124507091 CATATGCAGAAGATTGAAACTGG - Intergenic
1090300331 11:125630984-125631006 CAGTTGCAAAAGAATTCATATGG + Intronic
1090495123 11:127204428-127204450 CATATGCAGAAGATTGAAACCGG - Intergenic
1090505977 11:127314764-127314786 ATTGGGCAAAAGATTTAATCAGG - Intergenic
1090629208 11:128631974-128631996 CATTTGTAACAGATGTAATTGGG - Intergenic
1090641611 11:128734116-128734138 CATTTGCCAAAGATTTGACTTGG + Intronic
1091117585 11:133028651-133028673 CATATGCAAAAGAATGAAACTGG + Intronic
1091151545 11:133333438-133333460 CATATGCAGAAGATTGAAGCTGG + Intronic
1091525861 12:1300261-1300283 CATATGCAGAAGATTAAAACTGG + Intronic
1091528826 12:1334429-1334451 CATATGCAGAAGATTGAAACTGG - Intronic
1091966870 12:4751072-4751094 CATATGCAGAAGATTGAAACTGG + Intronic
1092209589 12:6637732-6637754 CCTTTGGAAAAGATCTCATCAGG + Intergenic
1092334135 12:7613873-7613895 CATATGCAGAAGATTGAAGCTGG + Intergenic
1092346781 12:7721799-7721821 CATATGCAAAAGAATTAAGTAGG - Intergenic
1092441192 12:8506204-8506226 CATATGCAAAAGATTGAAACTGG - Intergenic
1092608687 12:10149082-10149104 CATATGCAGAAGATTGAAACTGG - Intergenic
1092896759 12:13019455-13019477 CATTGGGAACAGATTTTATCTGG - Intergenic
1093134446 12:15433553-15433575 CATATGCAGAAGATTGAAACTGG - Intronic
1093189019 12:16053755-16053777 CATATGCAGAAGATTAAAACGGG + Intergenic
1093385130 12:18543586-18543608 CATATGCAGAAGATTGAAGCTGG - Intronic
1093491123 12:19705710-19705732 CATATGCAGAAGATTGAAACTGG + Intronic
1093492757 12:19724183-19724205 CATATGCAGAAGATTGAAGCTGG + Intergenic
1093521038 12:20050366-20050388 AATCTGCAAAAGATTTCAGCTGG - Intergenic
1093545951 12:20348240-20348262 CATATGCAGAAGATTGAAACTGG + Intergenic
1093575802 12:20728210-20728232 CATATGCAAAAGAATGAAACTGG - Intronic
1093581194 12:20785695-20785717 CATATGCAAAAGAATGAAACTGG - Intergenic
1093646752 12:21595051-21595073 CATGTGCAAAAGAATAAAACTGG + Intronic
1093655786 12:21692961-21692983 CATATGCAGAAGATTTAAACTGG + Intronic
1093761057 12:22911377-22911399 CATTTGCTTATCATTTAATCAGG - Intergenic
1093803734 12:23406877-23406899 CATATGCAAAAGAATGAAACTGG + Intergenic
1093865186 12:24217439-24217461 CACATGCAAAAGAATTAAACTGG + Intergenic
1094119025 12:26949442-26949464 CATTTGTAAATAAATTAATCTGG - Intronic
1094290259 12:28840312-28840334 CATATGCAGAAGATTGAAACTGG + Intergenic
1094310818 12:29080354-29080376 CATTTGCAGAAGAATAAAACTGG + Intergenic
1094782268 12:33804583-33804605 CATATGCAGAAGATTGAAACTGG - Intergenic
1094783233 12:33817593-33817615 CATATGCAGAAGATTGAAACTGG - Intergenic
1094785386 12:33842518-33842540 CATATGCAGAAGATTAAAACTGG + Intergenic
1095100123 12:38172582-38172604 CATATGCAGAAGATTGAAGCTGG - Intergenic
1095303046 12:40609633-40609655 CTTATGCAGAAGATTGAATCTGG - Intergenic
1095364548 12:41386919-41386941 CATATGCAGAAGATTGAAACTGG + Intronic
1095571627 12:43689470-43689492 CATATGCAGAAGATTGAATCTGG + Intergenic
1095687092 12:45049535-45049557 CATTAGCAATAAATTTGATCCGG + Intronic
1096900041 12:54867674-54867696 CATATGCAGAAGATTGAAACTGG - Intergenic
1096925585 12:55141156-55141178 CATATGCAGAAGATTGAAACTGG + Intergenic
1097298706 12:57995603-57995625 CACTTGCAAAAGAATAAAACTGG - Intergenic
1097318145 12:58195430-58195452 CATATGCAGAAGATTGAAGCTGG - Intergenic
1097364298 12:58694284-58694306 CATATGCAGAAGATTGAAACTGG + Intronic
1097419372 12:59355233-59355255 CATATGCAGAAGATTAAATTTGG - Intergenic
1097471716 12:60001354-60001376 CATATGCACAAGATTGAAACTGG - Intergenic
1097512363 12:60559899-60559921 CATACGCAGAAGATTTAAACTGG - Intergenic
1097520785 12:60668033-60668055 CATATGCAGAAGATTAAAACTGG - Intergenic
1097557570 12:61158560-61158582 CATATGCAGAAGATTGAAGCTGG + Intergenic
1097572530 12:61352566-61352588 CATTTACAAAATATATAATGTGG - Intergenic
1098145590 12:67494582-67494604 CATATGCAGAAGATTAAAGCTGG + Intergenic
1098345072 12:69493845-69493867 CATATACATAGGATTTAATCAGG + Intronic
1098473473 12:70872343-70872365 CCTTTGAAAAACATTTAATATGG - Intronic
1098641540 12:72844279-72844301 CATATGCAGAAGATTGAAACTGG + Intergenic
1098667185 12:73179336-73179358 CATATGCAAAAGATTGAAACTGG + Intergenic
1098682821 12:73379471-73379493 CATTTGCAAAGCATTTAGTAGGG + Intergenic
1098791718 12:74832530-74832552 CATATGCAGAAGATTGAAACTGG + Intergenic
1098801886 12:74970816-74970838 CATATGCAGAAGATTGAAACTGG + Intergenic
1099155535 12:79170888-79170910 CATATGAAAAAGATTGAAGCTGG - Intronic
1099164994 12:79294021-79294043 TATTTTCCAAAAATTTAATCTGG + Intronic
1099706588 12:86161451-86161473 CATATGCAGAAGATTGAAGCTGG + Intronic
1100196735 12:92254916-92254938 CATATGCAGAAGATTGAAACTGG - Intergenic
1100266678 12:92983678-92983700 CATATGCAGAAGATTGAAACTGG + Intergenic
1100928548 12:99579143-99579165 CATATGCAGAAGATTGAAACTGG + Intronic
1100932346 12:99624199-99624221 CATGTGCAAAAGATTAAAACTGG + Intronic
1101174017 12:102130187-102130209 CATGTGCAGAAGATTGAAACCGG + Intronic
1101220952 12:102640010-102640032 CATATGCAGAAGATTGAAACTGG + Intergenic
1101641553 12:106588594-106588616 CATTTGCAAAAGAATGGATTGGG + Intronic
1102205304 12:111086385-111086407 CATTAGAAAAAGAAATAATCAGG - Intronic
1103111238 12:118280391-118280413 CATATGCAGAAGATTGAAACTGG - Intronic
1103169693 12:118805765-118805787 CATATGCAGAAGATTTTAACTGG - Intergenic
1103801971 12:123543978-123544000 TATTTGCAAAGAATTTAATAAGG - Intergenic
1104158807 12:126159063-126159085 CACATGCAAAAGAATTAAACAGG + Intergenic
1104226011 12:126834105-126834127 CATATGCAGAAGATTGAAGCTGG - Intergenic
1104677729 12:130725524-130725546 CATATGCAGAAGATTGAAGCTGG + Intergenic
1105340985 13:19525491-19525513 CATATGCAGAAGATTGAAACTGG + Intronic
1105479297 13:20758965-20758987 CATTTGCAGAAGAGTAAAACTGG + Intronic
1105714099 13:23044578-23044600 CATCTGACAAATATTTAATCTGG + Intergenic
1105776115 13:23662230-23662252 CATATGCCAAAGATTAAAACTGG - Intronic
1105994021 13:25653154-25653176 CATATGCAAAAGATTGAAACTGG - Intronic
1106271442 13:28158142-28158164 CATATTCAAAAGATTGAAACTGG + Intronic
1106306814 13:28519276-28519298 CATTTGCAGAAGAATGAATGTGG + Intergenic
1106357108 13:28993606-28993628 CATATGCAAAAGAATGAAACTGG - Intronic
1106718247 13:32413432-32413454 CTTTTAAAAAACATTTAATCTGG - Intronic
1106837718 13:33653473-33653495 CATTTGCAAAAGAATGAAGTTGG + Intergenic
1106990080 13:35408305-35408327 CATATGCAGAAGATTGAAACTGG + Intronic
1107082879 13:36393896-36393918 CATATGCAGAAGATTGAAACTGG - Intergenic
1107167893 13:37304334-37304356 CATTAGCAAAAGATCCATTCAGG - Intergenic
1107226180 13:38050333-38050355 CATATGCAGAAGATTGAAACTGG + Intergenic
1107496329 13:40929069-40929091 CAATGGCCAATGATTTAATCAGG + Intergenic
1108020033 13:46118671-46118693 CATGTGCAAAAGAAATCATCTGG + Intergenic
1108031977 13:46241267-46241289 CATATGCAGAAGATTGAAACTGG + Intronic
1108231788 13:48352029-48352051 CATATGCAGAAGATTGAAGCTGG - Intronic
1108759759 13:53548658-53548680 CATATGCAGAAGATTAAAACTGG - Intergenic
1108801014 13:54094226-54094248 CATATGCAAAAGAATGAAACGGG - Intergenic
1108856991 13:54805510-54805532 CATTTGCAAAAGTACCAATCAGG - Intergenic
1108882629 13:55139863-55139885 CATTTGCAGAAGAATAAAACTGG - Intergenic
1108964864 13:56285538-56285560 CATATGCAAAAGATTGAAACTGG - Intergenic
1109076148 13:57837942-57837964 CATTTGCACAACATATAATGTGG + Intergenic
1109085113 13:57961439-57961461 CATTTGCAGAAAATTGAAACTGG - Intergenic
1109427002 13:62178203-62178225 CATTTGCAGAAAATTAAAACTGG + Intergenic
1109467965 13:62763483-62763505 CATATGCAGAAGATTGAAACTGG + Intergenic
1109476531 13:62886744-62886766 CATATGCAGAAGATTGAAACTGG - Intergenic
1109905400 13:68832957-68832979 CATATGCAGAAGATTAAAACTGG - Intergenic
1110062923 13:71064852-71064874 CATATGCAGAAGATTGAAGCTGG + Intergenic
1110089033 13:71421699-71421721 CACATGCAAAAGAATGAATCTGG - Intergenic
1110230198 13:73159988-73160010 CATATGCAGAAGATTGAAACTGG + Intergenic
1110334706 13:74314273-74314295 CATATGCAGAAGATTAAAACTGG - Intergenic
1110338164 13:74357032-74357054 CATATGCAGAAGATTGAAACAGG - Intergenic
1110460739 13:75742667-75742689 CATATGCAGAAGATTGAAACTGG + Intronic
1110501632 13:76234966-76234988 CATATGCAGAAGATTGAAACTGG - Intergenic
1110536140 13:76652765-76652787 CATATGCAGAAGATTGAAACTGG + Intergenic
1110610617 13:77483414-77483436 CATATGCAGAAGATTGAAACTGG - Intergenic
1110803727 13:79730901-79730923 CATATGCAAAAGATTGAAACTGG - Intergenic
1110947248 13:81437669-81437691 CAATAGAAAAAGATGTAATCAGG - Intergenic
1110971416 13:81766984-81767006 CATATGCAAAAGAATGAAACTGG + Intergenic
1110975419 13:81827368-81827390 CATTTCCAAAACTTTTAATTAGG - Intergenic
1111185882 13:84735306-84735328 CATATGCAGAAGATTAAACCTGG - Intergenic
1111370067 13:87305928-87305950 CATATGCAGAAGATTGAAACAGG - Intergenic
1111494259 13:89027354-89027376 CATTGGTAAAAGATTTAGTAAGG - Intergenic
1111576459 13:90160875-90160897 CATATGCAAAAAATTGAAACTGG + Intergenic
1111831204 13:93332006-93332028 CATTTGCAAAAGGGATGATCTGG - Intronic
1111851918 13:93586558-93586580 CATATGCAGAAGATTGAAACTGG + Intronic
1111857524 13:93657395-93657417 CATATGCAGAAGATTGAAACTGG + Intronic
1112223010 13:97510295-97510317 CATATGCAGAAGAATTAAACTGG - Intergenic
1112233929 13:97617876-97617898 CATATGCAGAAGATTAAAACTGG + Intergenic
1112682573 13:101783874-101783896 CATATGCAGAAGATTAAAACTGG - Intronic
1112736205 13:102422049-102422071 CATATGCAGAAGATTGAAACTGG + Intergenic
1112836446 13:103520213-103520235 CATTTGCTGAACATTTATTCTGG - Intergenic
1112980043 13:105372374-105372396 CCTTTGCCAAATTTTTAATCAGG - Intergenic
1113202325 13:107880181-107880203 CATATGCAGAAGATTGAAACTGG + Intergenic
1113227374 13:108174032-108174054 CATAAGCAGAAGATTGAATCTGG + Intergenic
1113247710 13:108417106-108417128 CATTTGCAGAAAATTGAAACTGG - Intergenic
1113390142 13:109888465-109888487 CATATGCAGAAGATTGAAGCTGG + Intergenic
1113394644 13:109935554-109935576 CATATGCAGAAGATTGAAGCTGG - Intergenic
1114160121 14:20156027-20156049 CATATGCAGAAGATTGAAACTGG + Intergenic
1114162861 14:20188535-20188557 CATGTGCAAAAAATTGAAACTGG + Intergenic
1114586718 14:23821604-23821626 CATATGCAGAAGATTGAAACAGG - Intergenic
1114589398 14:23846399-23846421 CATATGCAGAAGATTGAAACTGG - Intergenic
1114922698 14:27353485-27353507 TATTTGCAAAAGGTGAAATCTGG + Intergenic
1114989506 14:28269957-28269979 CATATGCAAAAGATTGAAAGTGG + Intergenic
1115127507 14:30014039-30014061 TATGTGCAAATGATTTAATGAGG + Intronic
1115177155 14:30576314-30576336 CATATGCAGAAGATTGAAGCTGG + Intronic
1115538519 14:34396446-34396468 CATATGCAGAAGATTGAAACTGG + Intronic
1115858844 14:37661366-37661388 CATTTGCAGAAAATTGAAACTGG - Intronic
1115931362 14:38499449-38499471 CATGTGCACAAGAATTAATCTGG - Intergenic
1116018924 14:39438446-39438468 CATATGCAAAAGAATTAAACTGG - Intergenic
1116119974 14:40710610-40710632 CATATGCAAAAGATTGAAACTGG + Intergenic
1116219532 14:42065172-42065194 CATATGCAGAAGACTTAAACTGG - Intergenic
1116343787 14:43761481-43761503 CATATGCAAAAGATTGAAGTTGG + Intergenic
1116526585 14:45913509-45913531 TATTTGAAAAATATTTATTCAGG + Intergenic
1116980322 14:51163112-51163134 CATTTCCAAAAGAATGACTCAGG + Intergenic
1117234529 14:53757425-53757447 CATTTGCAGAAGATCAAAACTGG + Intergenic
1117259658 14:54018487-54018509 CATTTGCAGAAAATTGAAACTGG + Intergenic
1117622802 14:57604901-57604923 CATATGCAAAAGAATGAAACTGG + Intronic
1117739527 14:58802598-58802620 CATATGCAGAAGATTGAAACTGG - Intergenic
1117823037 14:59671345-59671367 CAGTTGCAAAAGAAGTAATGAGG - Intronic
1117851145 14:59971125-59971147 CATATGCAGAAGATTGAAACTGG - Intronic
1118068552 14:62219462-62219484 CATATGCAGAAGATTAAAACTGG - Intergenic
1118313814 14:64712032-64712054 CACATGCAAAAGAATGAATCTGG - Intronic
1118479584 14:66150822-66150844 CATATGCAGAAGATTGAAACTGG + Intergenic
1118665998 14:68070474-68070496 CATATGCAAATGATTGAAACTGG - Intronic
1119094912 14:71820940-71820962 CATATGCAGAAGATTAAAACTGG - Intergenic
1119493542 14:75058800-75058822 CATATGCAAAAGAATAAAGCTGG + Intronic
1119763015 14:77166542-77166564 TATATGCAAAAGAATTAATTTGG - Intronic
1120029043 14:79619402-79619424 CATATGCAGAAGATTGAAACTGG - Intronic
1120064389 14:80023247-80023269 CATATGCAGAAGATTGAAACTGG - Intergenic
1120184455 14:81379789-81379811 CATTTGCAGAAGATTGAAAGTGG + Intronic
1120300567 14:82701285-82701307 CATATGCAGAAGATTGAAACTGG - Intergenic
1120426380 14:84352844-84352866 CATATGCAGAAGACTGAATCTGG + Intergenic
1120451181 14:84668471-84668493 CATTTGCCTATTATTTAATCAGG + Intergenic
1120630848 14:86888220-86888242 CATTTGCAGAAAATTGAAACTGG + Intergenic
1120833512 14:89019582-89019604 CACATGCAAAAGAATGAATCTGG - Intergenic
1120947129 14:90008494-90008516 CATTTGCCCAAGATTTCAACAGG - Intronic
1121725316 14:96143594-96143616 CATGTGCAGAAGATTAAATCTGG + Intergenic
1122421565 14:101581075-101581097 CATATGCAGAAGATTGAAACTGG - Intergenic
1123814104 15:23959343-23959365 CATATGCAGAAGATTGAAACTGG - Intergenic
1124020967 15:25922737-25922759 CATTTGCAGAAGATTGAAATTGG - Intergenic
1124246107 15:28071713-28071735 CATATGCAGAAGATTGAAGCTGG + Intronic
1124450291 15:29782489-29782511 CATATGCAGAAGATTGAAACTGG + Intronic
1124473937 15:30014624-30014646 CATAGGCAAAAGATTGAAACTGG - Intergenic
1125045052 15:35235702-35235724 CATTTTCAAAAGCTAAAATCTGG - Intronic
1125247876 15:37662273-37662295 CATATGCAGAAGATTGAAACTGG - Intergenic
1125309609 15:38364397-38364419 CATATGCAGAAGATTGAAACTGG - Intergenic
1125373768 15:39005971-39005993 CATTTGCAGAAAATTGAAACTGG + Intergenic
1125416475 15:39459089-39459111 CATGTGCAGAAGATTGAAACTGG - Intergenic
1125787720 15:42336427-42336449 CATATGCAGAAGATTGAAACTGG + Intronic
1126213664 15:46129864-46129886 CATATGCAAAAGATTGAAATTGG - Intergenic
1126227214 15:46285061-46285083 CATATGCAGAAGATTGAAACTGG - Intergenic
1126372044 15:47957690-47957712 CATATGCAGAAGATTGAAACTGG - Intergenic
1126455201 15:48853783-48853805 CATATGCAAAAGAATGAAACTGG + Intronic
1126520379 15:49586333-49586355 CATATGCAGAAGATTGAAACTGG + Intronic
1126565156 15:50089072-50089094 CATATGCAGAAGATTGAAACTGG + Intronic
1126956768 15:53941245-53941267 CATATGCAGAAGATTGAAACTGG + Intergenic
1127003444 15:54537782-54537804 CATATGCAGAAGATTAAAACTGG + Intronic
1127022054 15:54759287-54759309 CATATGCAGAAGATTGAAACTGG + Intergenic
1127058439 15:55156473-55156495 CATCTGCCAAAGATTGAAACTGG + Intergenic
1127180816 15:56415432-56415454 CATTTGCAGAAGACTGAAGCTGG - Intronic
1128363602 15:66980988-66981010 CATATGCAGAAGATTGAAGCTGG - Intergenic
1128592718 15:68916049-68916071 CATATGCAAAAGAATTAAGTTGG + Intronic
1128627098 15:69220955-69220977 CATATGCAAAAGAGTGAAGCTGG - Intronic
1128858792 15:71046885-71046907 CATATGCAGAAGATTGAAGCTGG - Intronic
1128921269 15:71612250-71612272 CTTTTGTAAAAGATGTAATGAGG + Intronic
1129560153 15:76557943-76557965 CATATGCAGAAGATTGAAACTGG + Intronic
1129560783 15:76564964-76564986 CATATACAGAAGATTTAAACTGG + Intronic
1129566471 15:76628472-76628494 CATATGCAGAAGATTGAAACTGG - Intronic
1129568615 15:76653653-76653675 CATATGCAGAAGATTGAAGCTGG + Intronic
1129602208 15:77006642-77006664 CACATGCAAAAGAATTAAGCTGG - Intronic
1129663008 15:77563666-77563688 CATATGCAAAAGAATGAAGCTGG - Intergenic
1129973374 15:79800175-79800197 CATATGCAAAAGAGTGAAGCTGG - Intergenic
1130424469 15:83781406-83781428 CATATGCAGAAGATTGAAACTGG + Intronic
1131295589 15:91146179-91146201 CATATGCAGAAGATTGAAACTGG - Intronic
1131301441 15:91203016-91203038 CATTTACAAAAAGTTTACTCTGG - Intronic
1131933802 15:97478533-97478555 CATATGCAGAAGATTGAAACTGG - Intergenic
1132007737 15:98244906-98244928 CATATGCAGAAGATTGAAACTGG - Intergenic
1132310848 15:100856862-100856884 TATTTGCAAAATATATAATTAGG + Intergenic
1132388354 15:101418923-101418945 GATTTCTAAGAGATTTAATCAGG - Intronic
1133093204 16:3421592-3421614 CATATGCAGAAGATTGAAACTGG - Intronic
1133664873 16:7956875-7956897 CATGTGCAAAAGAATGAATTTGG - Intergenic
1133902390 16:9989334-9989356 CATATGCAAAAGGCTAAATCTGG + Intronic
1134418416 16:14064655-14064677 CATATGCAGAAGATTGAAACTGG - Intergenic
1135192532 16:20366608-20366630 CAGTTGCAAAACATTTATTGAGG - Intronic
1136601466 16:31293441-31293463 CATATGCAGAAGATTGAAACTGG - Intronic
1136640448 16:31559976-31559998 CATATGCAGAAGATTGAAGCTGG + Intergenic
1137330341 16:47488641-47488663 CATATGCAGAAGATTGAAACTGG - Intronic
1137523614 16:49214386-49214408 CATTTGTAAAAAACTTATTCTGG + Intergenic
1138306869 16:55985499-55985521 CATATGCAGAAGATTGAAACTGG - Intergenic
1138312052 16:56034410-56034432 CATTTGCAATATATTGAATGTGG + Intergenic
1138690200 16:58760357-58760379 CATATGCAAAAGAATGAAACTGG - Intergenic
1138826275 16:60323914-60323936 CATATGCAGAAGATTAAAACTGG - Intergenic
1138976076 16:62209635-62209657 CATATGCAGAAGATTAAAACTGG - Intergenic
1139115058 16:63941039-63941061 CATATGCAAAATATTGAAACTGG - Intergenic
1139235731 16:65336654-65336676 CATATGCAAAAGAATGAATTTGG + Intergenic
1139849982 16:69945434-69945456 CATTTGAAAAAGAATAAAACTGG - Intergenic
1139878968 16:70168346-70168368 CATTTGAAAAAGAATAAAACTGG - Intergenic
1140024253 16:71269940-71269962 CATTTTCAAAATATTTAAAGTGG - Intergenic
1140235938 16:73158873-73158895 CATATGCAGAAGATTGAAACTGG + Intergenic
1140373551 16:74427147-74427169 CATTTGAAAAAGAATAAAACTGG + Intergenic
1142332605 16:89464306-89464328 CATTTTGAAAAGAATAAATCTGG + Intronic
1143196922 17:5082827-5082849 AATTTTTAAAAGATGTAATCAGG + Intronic
1143822523 17:9576350-9576372 CATTTAAAAAATATGTAATCAGG - Intronic
1143991701 17:10969312-10969334 CATATGCAGAAGATTGAAACTGG + Intergenic
1144142260 17:12361205-12361227 AATTTACAACAGAGTTAATCTGG + Intergenic
1144400708 17:14896912-14896934 CATGTGCAAAAGAATGAATCTGG - Intergenic
1145278026 17:21447273-21447295 CATATGCAGAAGATTGAAACTGG - Intergenic
1145315849 17:21733144-21733166 CATATGCAGAAGATTGAAACTGG - Intergenic
1145714274 17:27005074-27005096 CATATGCAGAAGATTGAAACTGG - Intergenic
1145720684 17:27069234-27069256 CACATGCAAAAGATTGAAACTGG - Intergenic
1146248121 17:31309387-31309409 ATTTTGCAAAAGATTTAAAAGGG + Intronic
1146803945 17:35850303-35850325 CACTTACTAAAGATTTGATCTGG - Intronic
1147529174 17:41258058-41258080 CATTTGCAGAAGATTGAAACTGG - Intergenic
1148203903 17:45767716-45767738 CCTTTGCAAAGGATTAAATAAGG + Intergenic
1148967021 17:51444245-51444267 CATATGCAGAAGATTGAAACTGG + Intergenic
1149014903 17:51897266-51897288 CATATGCAGAAGATTGAAACTGG - Intronic
1149022147 17:51980714-51980736 CATGTGCAGAAGATTGAAGCTGG - Intronic
1149106059 17:52966837-52966859 CATATGCAGAAGATTGAAACTGG - Intergenic
1149114434 17:53074999-53075021 CATATGCAAGAGATTGAAACTGG - Intergenic
1149395310 17:56235550-56235572 CATATGCAGAAGATTGAAACGGG - Intronic
1150459848 17:65340789-65340811 CATATGCAGAAGATTGAAACTGG + Intergenic
1150533361 17:66009659-66009681 CATATACAAAAGATTGAAACTGG - Intronic
1150853481 17:68728034-68728056 CATATGCAGAAGATTGAAACTGG + Intergenic
1151003163 17:70401766-70401788 CATCTGCAAAAGATATAACAAGG + Intergenic
1151027379 17:70694387-70694409 CATATGCAAAAGAATGAAACTGG - Intergenic
1151165917 17:72203846-72203868 AATTTGCAAAAGAATTACTGGGG - Intergenic
1153085627 18:1283153-1283175 CATGTGCAGAAGAATTAAACTGG + Intergenic
1153094771 18:1388251-1388273 CATGTGCAGAAGATTGAAACTGG + Intergenic
1153411149 18:4794589-4794611 CATATGCAAAAGATTGAAACTGG + Intergenic
1153645241 18:7190000-7190022 GATTTGTAAAAGATTTAAAATGG + Intergenic
1153740082 18:8115689-8115711 CTGTAGCAGAAGATTTAATCAGG + Intronic
1153760499 18:8326743-8326765 CATATGCAGAAGATTGAAACTGG + Intronic
1154183017 18:12153901-12153923 CATATGCAAAAGATTGAAGCTGG + Intergenic
1154401930 18:14047269-14047291 CATATGCAGAAGATTGAAACTGG - Intergenic
1154469577 18:14686482-14686504 CATATGCAGAAGATTGAAGCTGG - Intergenic
1155375766 18:25155615-25155637 CATTTGCAAAAGAATGAAATTGG - Intronic
1155779772 18:29816366-29816388 CATATGCAGAAGATTGAAACTGG + Intergenic
1155844887 18:30693980-30694002 CATATGCAGAAGATTGAAACTGG - Intergenic
1155861641 18:30909048-30909070 CATATGCAAAAGACTAAACCTGG + Intergenic
1156087117 18:33419234-33419256 TATATGCAAAAGATTGAAACTGG + Intronic
1156125189 18:33896575-33896597 CATATGCAGAAGATTGAAGCTGG + Intronic
1156238065 18:35223320-35223342 CATATGCAGAAGATTGAAACTGG - Intergenic
1156654238 18:39264738-39264760 CATATGCAGAAGATTGAAACTGG + Intergenic
1156699593 18:39809806-39809828 CATATGCAGAAGATTGAAACTGG - Intergenic
1156884966 18:42124446-42124468 CATTTGCAGAAAATTGAAACTGG + Intergenic
1156959645 18:43009669-43009691 AATTTTCATAAGATTTAGTCTGG - Intronic
1157054036 18:44203901-44203923 CATTTGCAGAAGATTGAAGCTGG + Intergenic
1157054587 18:44211571-44211593 CATTTGTAGAAGATTGAAACTGG + Intergenic
1157064552 18:44332521-44332543 CATATGCAAAATATTAAAACTGG - Intergenic
1157773657 18:50373596-50373618 CTTTTGTAAAAAATGTAATCTGG - Intergenic
1158037328 18:53049381-53049403 CATATGCAGAAGATTGAAACTGG - Intronic
1158127005 18:54111447-54111469 CATATGCAGAAGATTTAAACTGG - Intergenic
1158267346 18:55674641-55674663 CTTTTGCAAAAGGTCTATTCAGG + Intergenic
1158795730 18:60843945-60843967 CATATGCAGAAGATTGAAACTGG + Intergenic
1158851587 18:61500291-61500313 CATTTGCAAATGCTTTAAGATGG + Intronic
1158914375 18:62106951-62106973 AATTTGCAAATGTTGTAATCTGG + Intronic
1159301914 18:66583796-66583818 CATATACAAAAGATTGAAACTGG + Intronic
1159302792 18:66597401-66597423 CATATTCAGAAGATTTAAACTGG + Intronic
1159331305 18:66997349-66997371 CATATGCACAAGATTGAATCTGG + Intergenic
1159387735 18:67747288-67747310 CATATGCAGAAGATTTAAACTGG + Intergenic
1159400158 18:67920964-67920986 CATATGCAGAAGATTGAAGCTGG - Intergenic
1159479902 18:68976517-68976539 CAATTGCAAAAGTAATAATCGGG - Intronic
1159486090 18:69059094-69059116 CATATGCAAAAGAATAAAGCTGG - Intergenic
1159514272 18:69437353-69437375 CATATGCAAAAGACTGAAACTGG - Intronic
1159958499 18:74537331-74537353 CATATGCAGAAGATTGAAACTGG - Intronic
1160013200 18:75122225-75122247 CATTGGCAAAAGGTTACATCAGG + Intergenic
1160108255 18:76000253-76000275 CATATGCAAAAGGTTAAAACTGG - Intergenic
1160275217 18:77426327-77426349 CATATGCAGAAGATTGAAACTGG - Intergenic
1163379168 19:16953160-16953182 CATATGCAAAAGAATGAATTTGG + Intronic
1164389783 19:27807983-27808005 CATATGCAAAAGAATAAAACTGG + Intergenic
1164448635 19:28339351-28339373 CATATGCAGAAGATTGAAGCTGG - Intergenic
1164496593 19:28769890-28769912 CATATGCAGAAGATTGAAACTGG - Intergenic
1165683524 19:37798023-37798045 CATATGCAGAAGATTCAAGCTGG - Intronic
1165965243 19:39572212-39572234 CATATGCAGAAGATTGAAACTGG - Intergenic
1165967972 19:39600333-39600355 CATATGCAGAAGATTGAAACTGG + Intergenic
1166239893 19:41483115-41483137 CATTTGCAGAAGAATAAACCTGG + Intergenic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166591177 19:44000845-44000867 CATATGCAGAAGATTGAAACTGG - Intergenic
1168174119 19:54610536-54610558 CATATGCAAAAGAATGAAACTGG + Intronic
1168175090 19:54621883-54621905 CATATGCAAAAGAATAAAACTGG - Intronic
1168562013 19:57392481-57392503 CATATGAAAAAGAATGAATCTGG - Intronic
1202637854 1_KI270706v1_random:57340-57362 CATTTGGAAAATTTGTAATCTGG - Intergenic
925078819 2:1043609-1043631 CATATGCAGAAGATTGAAACTGG - Intronic
925419453 2:3700195-3700217 CATATGCAGAAGATTGAAACAGG - Intronic
925495106 2:4439005-4439027 CATTTGAAGAAAATTTAATCTGG - Intergenic
925932457 2:8720239-8720261 AATTTGAAATAGATTTAAACTGG - Intergenic
925952881 2:8931782-8931804 CATGTGCAAAAAATTGAATCTGG - Intronic
926502220 2:13670385-13670407 CATATGCAGAAGATTGAAACTGG - Intergenic
926548989 2:14278209-14278231 CATATGCAGAAGATTAAAACTGG - Intergenic
926929178 2:18019419-18019441 CATATGCAGAAGATTGAAACTGG - Intronic
926949808 2:18229115-18229137 CATATGCAGAAGATTAAAGCTGG - Intronic
926964367 2:18393758-18393780 CATGTGCAGAAGATTGAAACTGG + Intergenic
927001328 2:18797094-18797116 CATTTCCATAAGATGTAATGAGG - Intergenic
927070241 2:19521142-19521164 CATTTGCAAAAGAATGAAGCTGG + Intergenic
927401032 2:22710405-22710427 CATATGCAAAAGAATGAAACTGG - Intergenic
927623599 2:24688943-24688965 CATATGCAGAAGATTAAAACTGG - Intronic
928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG + Intronic
928386690 2:30875126-30875148 CATTTGCAGAAAATTAAAACTGG - Intergenic
928592297 2:32829806-32829828 CATATGCAGAAGATTGAAACTGG + Intergenic
928679883 2:33690832-33690854 CATATGCAGAAGATTGAAACTGG - Intergenic
928729054 2:34209791-34209813 CATATGCAGAAGATTAAAACTGG + Intergenic
928781553 2:34828171-34828193 CATTTATAAAAAATTTATTCTGG - Intergenic
928942926 2:36745012-36745034 CATATGCAAAAGAATGAAACTGG - Intronic
928955546 2:36863371-36863393 CATATGCAGAAGATTGAAACTGG - Intronic
929255391 2:39805553-39805575 CATATACAGAAGATTGAATCTGG - Intergenic
929357514 2:41043658-41043680 CATATGCAGAAGATTGAAACTGG + Intergenic
929523221 2:42674543-42674565 TCTTTGCAAAGTATTTAATCTGG + Intronic
930282782 2:49390730-49390752 CATATACAAAAGATTGAAACTGG + Intergenic
930395487 2:50818477-50818499 CATATGCAAAAGATTGAAACTGG + Intronic
930546420 2:52772911-52772933 CATATGCAGAAGATTGAAGCTGG + Intergenic
930598686 2:53418838-53418860 CATATGCAGAAGATTGAAACTGG - Intergenic
930663209 2:54076134-54076156 CATATGTAAAATATTAAATCTGG + Intronic
930677117 2:54214436-54214458 CATATGCAGAAGATTGAAACTGG - Intronic
930819432 2:55630741-55630763 TATTTTCAAAGCATTTAATCAGG - Intergenic
931153940 2:59606799-59606821 CATATGCAAAACAATTAATTTGG - Intergenic
931154452 2:59612145-59612167 CATATGCAAAAGATTGAAACTGG - Intergenic
931316523 2:61138133-61138155 CATTTGCAAAAAGTTTTCTCCGG + Intergenic
931454268 2:62395387-62395409 CATATGCAGAAGATTAAAACTGG + Intergenic
931543709 2:63357068-63357090 CATATGCAGAAGATTGAAGCTGG + Intronic
931779932 2:65570459-65570481 CATATGCAGAAGATTGAAACTGG - Intergenic
931798486 2:65735302-65735324 CATATGCAGAAGATTAAAACTGG - Intergenic
931921600 2:67022764-67022786 CATATGCAGAAGATTGAAACTGG + Intergenic
932105725 2:68939921-68939943 CATATGCAGAAGATTGAAGCTGG - Intergenic
932506200 2:72234053-72234075 CATATGCAGAAGATTGAAGCTGG + Intronic
932600520 2:73121529-73121551 CACATGCAAAAGAATTAAGCAGG + Intronic
932889735 2:75581869-75581891 CATTTGAAAAATATTTTCTCTGG - Intergenic
932930153 2:76026475-76026497 CATATGCAAAAGAATGAAACTGG + Intergenic
933048883 2:77576488-77576510 CATATGCAGAAGATTGAAACTGG + Intronic
933124240 2:78584261-78584283 CTTTTGCAAAAGTTTTAAGCTGG - Intergenic
933359038 2:81254009-81254031 CATCTGCAGAAGATTGAACCAGG - Intergenic
933579983 2:84114826-84114848 CATATGCAGAAGATTGAAGCTGG - Intergenic
933641012 2:84760110-84760132 CATTTGCAGAAGAATGAAACTGG + Intronic
933841258 2:86287884-86287906 CATTTGTAGAAGATGTAAACAGG - Intronic
933914929 2:86980660-86980682 AACTTTCAAAAGATATAATCAGG + Intronic
934008065 2:87789240-87789262 AACTTTCAAAAGATATAATCAGG - Intronic
934127119 2:88906304-88906326 CATGTGCAGAAGATTGAAACTGG + Intergenic
934148680 2:89122227-89122249 CATATGCAGAAGATTGAAACTGG + Intergenic
934218615 2:90059816-90059838 CATATGCAGAAGATTGAAACTGG - Intergenic
935449720 2:103195201-103195223 CATATGCAGAAGATTGAAACTGG + Intergenic
935459940 2:103318429-103318451 CATATGCAGAAGGTTTAAACTGG - Intergenic
935481815 2:103599021-103599043 CATATGCAAAAGACTGAAACTGG + Intergenic
935771705 2:106430182-106430204 AACTTTCAAAAGATATAATCAGG - Intronic
935908368 2:107865767-107865789 AACTTTCAAAAGATATAATCAGG + Intronic
935977170 2:108590038-108590060 CATTTGGAAAACATTTATTAAGG + Intronic
935994772 2:108757994-108758016 AACTTTCAAAAGATATAATCAGG + Intronic
936130153 2:109830893-109830915 AACTTTCAAAAGATATAATCAGG + Intronic
936214544 2:110540592-110540614 AACTTTCAAAAGATATAATCAGG - Intronic
936423680 2:112395155-112395177 AACTTTCAAAAGATATAATCAGG - Intronic
936705141 2:115063711-115063733 CATATGCAGAAAATTGAATCTGG + Intronic
936838370 2:116736957-116736979 CATATGCAAAAGAATGAAACTGG + Intergenic
936857196 2:116973083-116973105 CATATGCAAAAGATTGAAACTGG - Intergenic
937397645 2:121552135-121552157 CATCTGCAGAAGATTAAAGCTGG + Intronic
937550296 2:123080448-123080470 CATATGCAAAAGAATGAAACTGG - Intergenic
937569476 2:123338294-123338316 CATAAGCAAAAGATTGAAGCTGG + Intergenic
937586592 2:123558947-123558969 CATATGCAGAAGATTAAAACTGG - Intergenic
937607012 2:123812745-123812767 CATGTGCAGAAGATTAAAACTGG + Intergenic
937753038 2:125500913-125500935 CATATGCAGAAGATTGAAACTGG - Intergenic
937754592 2:125521210-125521232 CATATGCAAAAGAATAAAACTGG + Intergenic
937806747 2:126153766-126153788 CATATGCAGAAGATTGAAACTGG - Intergenic
938660271 2:133479829-133479851 CATTAGAAAAAGATATAAACTGG + Intronic
939236545 2:139501696-139501718 CATATGCAGAAGATTGAAGCTGG + Intergenic
939403920 2:141731282-141731304 CATTTTCAAAAGATTCAAGCAGG - Intronic
939515263 2:143158878-143158900 CTATTGCAAAAGGTTTAATGTGG + Intronic
939562624 2:143750727-143750749 CGTTTGCAACAGATTTTATGTGG + Intronic
939593902 2:144101227-144101249 CATTTTCCAAAGTTTTATTCAGG + Intronic
939639568 2:144622980-144623002 CATATGCAAAAGATTGAAACTGG - Intergenic
939747804 2:145999121-145999143 CATATGCAGAAGATTGAAACTGG + Intergenic
939947909 2:148432563-148432585 CATATGCAGAAGATTGAAACTGG - Intronic
939987332 2:148843319-148843341 CATATGCAGAAGATTGAAACTGG - Intergenic
940016756 2:149114526-149114548 CATTTCCAACAGTTTTAATTTGG - Intronic
940340916 2:152580039-152580061 CAGTCGCAAAAGGTTTAATCAGG - Intronic
940429372 2:153570653-153570675 CATATGCAGAAGAATTAAACAGG - Intergenic
940456524 2:153908587-153908609 CATATGCAGAAGATTGAAACTGG - Intronic
940579411 2:155558568-155558590 CATATGCAGAAGATTGAAACTGG + Intergenic
940671893 2:156680276-156680298 CATTTGCAAAATAATTATTTCGG - Intergenic
940708319 2:157131577-157131599 CATCTGCAGAAGATTAAAACTGG + Intergenic
940812523 2:158261313-158261335 CATATGCAGAAGATTGAAGCTGG + Intronic
941012016 2:160310759-160310781 GATTTGCAGAATGTTTAATCTGG - Intronic
941034884 2:160557642-160557664 CATATGCAGAAGATTGAAGCTGG + Intergenic
941077837 2:161026394-161026416 CATATGCAGAAGATTGAAACTGG + Intergenic
941146155 2:161848577-161848599 CATATGCAGAAGATTGAAACGGG - Intronic
941193006 2:162410372-162410394 CATATGCAGAAGATTGAAACTGG + Intronic
941267689 2:163383451-163383473 CATATGCAGAAGATTGAAACTGG - Intergenic
941278701 2:163523098-163523120 CATATGCAGAAGATTGAAACTGG - Intergenic
941418929 2:165258360-165258382 CATATGCAGAAGATTGAAACTGG - Intronic
941680929 2:168398340-168398362 CATATGCAGAAGATTGAAACTGG - Intergenic
942009264 2:171742471-171742493 CATATGCAAAAGAATAAAGCTGG - Intronic
942828366 2:180208330-180208352 CATATGCAAAAGATTGAAACTGG - Intergenic
943016293 2:182514613-182514635 CATATGCAGAATATTTAAACTGG + Intronic
943030276 2:182677815-182677837 CATATGCAGAAGATTGAAACTGG + Intergenic
943164795 2:184307380-184307402 CATATGCAGAAGATTGAAACTGG - Intergenic
943177465 2:184495496-184495518 CATATGCAGAAAATTTAAGCTGG + Intergenic
943316249 2:186391732-186391754 CATATGCAGAAGATTGAAACTGG + Intergenic
943351406 2:186800911-186800933 CATATGCACAAGATTGAAACTGG - Intergenic
943391527 2:187275167-187275189 CATATGCAAAAGATTGAAACTGG - Intergenic
943425059 2:187721121-187721143 CATATGCAGAAGATTGAAACTGG - Intergenic
943646905 2:190416091-190416113 TATTGGCACAATATTTAATCAGG + Intronic
943945110 2:194050994-194051016 CATTTGCAGAAGATTAAAGCTGG + Intergenic
944232053 2:197406016-197406038 GTTTTGCAAAAGGTTTGATCAGG - Intronic
944248713 2:197559657-197559679 CATGTGCAAAAGATTGAAATCGG - Intergenic
944371018 2:198984106-198984128 CATATGCAGAAAATTTAAACCGG + Intergenic
944537059 2:200721290-200721312 CATATGCAGAAGATTTAAACTGG + Intergenic
944627733 2:201589549-201589571 CATATGCAGAAGATTGAAACTGG + Intronic
944867212 2:203874405-203874427 CATTTGCAAAATAGTTCATTTGG - Intergenic
945008911 2:205440990-205441012 CAATTGTAAAAGATTTATTCAGG + Intronic
945023889 2:205601695-205601717 CATATGCAGAAAATTTAAACTGG - Intronic
945156121 2:206839978-206840000 CATATGCAGAAGATTGAAACTGG - Intergenic
945294009 2:208152838-208152860 CATATGCAGAAGATTGAAACTGG + Intergenic
945308123 2:208279595-208279617 CATATGCAAAAGAATAAAACTGG - Intronic
945356873 2:208850813-208850835 CATATGCAGAAGATTGAAACTGG - Intronic
945359877 2:208884491-208884513 CATATGCAGAAGATTAAAACTGG + Intergenic
945366696 2:208963567-208963589 CATACGCAGAAGATTTAAACTGG + Intergenic
945451096 2:209996647-209996669 TATTTGCAAAATATATAAACTGG - Exonic
945536012 2:211018884-211018906 CATATGCAGAAGATTGAAACTGG - Intergenic
945595513 2:211785615-211785637 CATGTGCAAAAGATTGAACTTGG - Intronic
945820415 2:214657837-214657859 CATATGCAGAAGATTGAAACTGG - Intergenic
946579854 2:221116634-221116656 CAATTGAAAAATAATTAATCTGG + Intergenic
946878402 2:224153398-224153420 CATATGCAGAAGATTGAAACTGG - Intergenic
947022084 2:225690395-225690417 CAATTTCAAAAGATTTATTGAGG + Intergenic
947198181 2:227590130-227590152 CATATGCAGAAGATTGAAACTGG - Intergenic
947327636 2:228995083-228995105 CATTTGGAATAGATGTAATTAGG - Intronic
947438349 2:230093227-230093249 CATATGCAGAAGATTGAAACTGG + Intergenic
947915066 2:233826516-233826538 CATTTGCAGAAAATTGAAACTGG + Intronic
948038879 2:234883393-234883415 CATTGGTAAAAGATTGAAACTGG + Intergenic
948331361 2:237168995-237169017 CATATGCAGAAGATTGAAGCTGG - Intergenic
948538788 2:238669946-238669968 AATTTGAAAAAGACTTATTCAGG + Intergenic
1168945253 20:1748998-1749020 CATATGCAGAAGATTGAAACTGG + Intergenic
1169024735 20:2359885-2359907 CATGTGCAGAAGATTGAAACTGG - Intergenic
1169540902 20:6598615-6598637 CATTTTCAAAAGATTTCTTTGGG + Intergenic
1169789547 20:9395078-9395100 TATTTGCAACTGATTTAATGGGG - Intronic
1170053072 20:12168356-12168378 CATATGCAGAAGATTTAAGCTGG - Intergenic
1170107735 20:12769604-12769626 CATATGCAGAAGATTGAAACTGG + Intergenic
1170190954 20:13644736-13644758 CATATGCAGAAGATTGAAACTGG - Intergenic
1170518430 20:17156635-17156657 CATATGCAAAAGAATGAAACTGG - Intergenic
1170977340 20:21177771-21177793 CATATGCAAAAGAATGAAACTGG - Intronic
1171053005 20:21878494-21878516 CATATGCAGAAGATTGAAACAGG - Intergenic
1171130754 20:22651071-22651093 CATATGCAGAAGATTGAAACAGG - Intergenic
1171195765 20:23197921-23197943 CCTTTGCTAATGTTTTAATCCGG - Intergenic
1171228592 20:23463013-23463035 CATATGCAGAAGATTGAAACTGG - Intergenic
1171239750 20:23555975-23555997 CATATGCGGAAGATTGAATCTGG - Intergenic
1171884425 20:30641432-30641454 CATTTGGAAAATTTGTAATCTGG - Intergenic
1171937711 20:31291570-31291592 CATATGCAGAAGATTGAAACTGG + Intergenic
1172532038 20:35638338-35638360 AATGGGCAAAAGATTTGATCAGG + Intronic
1172863948 20:38080395-38080417 CATATGCAGAAGATTAAAACTGG - Intronic
1173574341 20:44101214-44101236 CGTATGCAAAAGATTGAAACTGG + Intergenic
1173697643 20:45033470-45033492 CATATGCAAAAGACTGAAACTGG - Intronic
1173700319 20:45064120-45064142 CATATGCAGAAGATTAAAACTGG - Intronic
1173762783 20:45578744-45578766 CATTTTCAAAAAATTAAAACAGG - Intronic
1173901152 20:46589793-46589815 CATGTGGAAAAGAATGAATCTGG + Intronic
1174965176 20:55205334-55205356 CATATGCAGAAGATTGAAACTGG - Intergenic
1175092514 20:56516647-56516669 CATTTGCAAAAATTTAAATGAGG - Intronic
1175638768 20:60608764-60608786 CATATGCAGAAGATTGAAACAGG + Intergenic
1176804920 21:13471165-13471187 CATATGCAGAAGATTGAAGCTGG + Intergenic
1177028546 21:15953368-15953390 CATATGCAGAAGATTGAAACTGG - Intergenic
1177304613 21:19297030-19297052 CATATGCACAAAATTTAAACTGG + Intergenic
1177320676 21:19515651-19515673 CATATGCAGAAGATTGAAACTGG + Intergenic
1177454688 21:21321613-21321635 CATATGCAAAAGAATTCAACTGG - Intronic
1177575096 21:22943847-22943869 CATATGCAGAAGATTGAAACTGG - Intergenic
1177655796 21:24015236-24015258 TATTTTCAAAAGATTCATTCTGG + Intergenic
1177666542 21:24167127-24167149 CATTTGCAGAAGATTGAAAATGG - Intergenic
1177746849 21:25225960-25225982 CACATGCAAAAGAATTAAGCTGG - Intergenic
1177747679 21:25240096-25240118 CATGTGCAAAAGAATAAATCTGG + Intergenic
1177756399 21:25353695-25353717 CATATGCAGAAGATTGAAACTGG + Intergenic
1177759984 21:25392379-25392401 CATTTGCACAAGATATTTTCTGG + Intergenic
1177875625 21:26627446-26627468 CATTTGCAAAAGAATCTATAGGG - Intergenic
1178033959 21:28559919-28559941 CATATGCAGAAGATTGAAACTGG + Intergenic
1178046637 21:28702125-28702147 CATATGCAGAAGATTGAAACTGG + Intergenic
1178177462 21:30119323-30119345 CATGTAGAAAAGATTTAATCTGG - Intergenic
1178620520 21:34170047-34170069 CATTTGGGAAAGCTTCAATCAGG - Intergenic
1178739406 21:35183978-35184000 CATATGCAAAAAATTGAAACTGG - Intronic
1179083418 21:38194763-38194785 CATATGCAGAAGATTGAACCTGG - Intronic
1179256171 21:39717537-39717559 CATATGCAGAAGATTGAAGCTGG - Intergenic
1179300852 21:40108944-40108966 CATATGCAGAAGATTGAAGCTGG + Intronic
1179313463 21:40218189-40218211 CATATGCAGAAGATTGAAGCTGG - Intronic
1179320272 21:40284822-40284844 CATTTACAAAAGAAGTAACCTGG - Intronic
1181485544 22:23229459-23229481 CATTTTCAGAACATTTAAACAGG - Intronic
1181794662 22:25297248-25297270 CATATGCAGAAGATTGAAACTGG - Intergenic
1181834647 22:25593801-25593823 CATATGCAGAAGATTGAAACTGG - Intronic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1184307112 22:43612106-43612128 CATATGCAGAAGATTGAAACTGG + Intronic
1184318699 22:43721688-43721710 CATATGCAGAAGAATGAATCTGG + Intronic
949122570 3:404367-404389 CATTTGGAAAAAATATAATTTGG - Intronic
949229897 3:1738395-1738417 CATATGCATAAGATTAAAACTGG - Intergenic
949560807 3:5200557-5200579 AATTTTCAAAAGATGTAAACAGG - Intronic
949661851 3:6288558-6288580 CATATGCAGAAGATTGAAACTGG + Intergenic
949817947 3:8081060-8081082 CATTTGCAGAAGAATGAAACTGG - Intergenic
950298415 3:11852131-11852153 CATTTGCAAATGTTATAGTCTGG + Intergenic
950947777 3:16967959-16967981 CATATGCAGAAGATTGAAACTGG - Intronic
951153865 3:19325144-19325166 CATATGCAGAAGATTGAAACTGG + Intronic
951261007 3:20508592-20508614 CATATGCAAAAGAATGAAACTGG - Intergenic
951283792 3:20784532-20784554 CATATGCAGAAGATTGAAGCTGG + Intergenic
951296858 3:20947807-20947829 CATATGCAGAAGATTAAAACTGG - Intergenic
952026229 3:29086072-29086094 CATATGCAGAAGATTGAAGCTGG - Intergenic
952228226 3:31401278-31401300 CATATGCAGAAGATTGAAACTGG - Intergenic
952518264 3:34127789-34127811 CATATGCAGAAAATTGAATCTGG + Intergenic
952546603 3:34426799-34426821 CATATGCAGAAGATTGAAACTGG + Intergenic
953162497 3:40434165-40434187 GATTTTCAACTGATTTAATCAGG + Intergenic
953539168 3:43800018-43800040 CATATGCAAAAGAATGAATTTGG + Intergenic
954480121 3:50791626-50791648 CATATGCAGAAGATTGAAACTGG - Intronic
954679682 3:52336629-52336651 CATATGCAGAAGATTGAAACCGG - Intronic
954857285 3:53655975-53655997 CATATGCACAAGATTGAAACTGG - Intronic
954930553 3:54277324-54277346 CATATGCAGAAGATTGAAACTGG - Intronic
955014381 3:55055254-55055276 CACTTGCAAAAGAATGAAACTGG - Intronic
955049803 3:55399209-55399231 CATATGCAGAAGATTGAAGCTGG + Intergenic
955806620 3:62742570-62742592 CATATGCAGAAGATTGAAACTGG + Intronic
955884684 3:63585083-63585105 CATTTACAAAAGAATAATTCTGG + Intronic
956256817 3:67292013-67292035 CGTTTGCAAAGCATTTAATATGG - Intergenic
956303751 3:67801992-67802014 CATTTAAAAAAAATTTATTCAGG + Intergenic
956492573 3:69789306-69789328 CCTTTGCCAATTATTTAATCAGG - Intronic
956859985 3:73313289-73313311 CATATGCAGAAGATTGAAACTGG - Intergenic
957160113 3:76600240-76600262 CATATGCAGAAGATTGAAACTGG - Intronic
957455187 3:80432403-80432425 CATATGCAGAAGATTGAACCTGG + Intergenic
957482668 3:80818478-80818500 GATGTGCAAAAGATTGAAACTGG + Intergenic
957660245 3:83141373-83141395 AATTTGGTAAAGATTTAATTTGG - Intergenic
957814532 3:85276960-85276982 CCTTTGAAAAAAATTTAATATGG + Intronic
957870604 3:86086518-86086540 CATTTGTAAAAAACTTAATTTGG + Intergenic
957874391 3:86127114-86127136 TATTTGGAAAAGATCTATTCTGG + Intergenic
957915066 3:86677903-86677925 CATATGCCAAAGATTGAAACTGG - Intergenic
958107073 3:89089303-89089325 CATATGCAAAAGAATTAAGTTGG + Intergenic
958129049 3:89394108-89394130 CCTTGGCAAAAGATTAAGTCAGG + Intronic
958135409 3:89483323-89483345 CTGTTGCAAACGATTTAATGAGG - Intergenic
958157092 3:89769319-89769341 CATTTGCAGAAAATTGAAACCGG - Intergenic
958463051 3:94423203-94423225 CATATGCAGAAGATTAAAACTGG + Intergenic
958484121 3:94681473-94681495 CATTTGCAGAAAATTGAAACTGG + Intergenic
958589705 3:96139998-96140020 CATATACAAAAGATTGAAACTGG + Intergenic
958605869 3:96357678-96357700 CATGTGCAGAAGATTGAAACTGG - Intergenic
958605955 3:96358706-96358728 CATATGCAGAAGATTGAAACTGG + Intergenic
958637051 3:96758348-96758370 CATTTGCACATTATTTAATTGGG + Intergenic
958687856 3:97423946-97423968 CATATGCAGAAGATTGAAACCGG + Intronic
958774002 3:98459332-98459354 CATATGCAGAAGATTGAAGCTGG - Intergenic
958807567 3:98830433-98830455 CATATGCAGAAGATTGAAGCTGG - Intronic
958854534 3:99368681-99368703 CATATGCAGAAGATTGAAGCTGG - Intergenic
958872253 3:99574246-99574268 CAGATGCAAAAGATTGAAACTGG + Intergenic
958998330 3:100932149-100932171 CATATGCAGAAGATTGAAGCTGG + Intronic
959004273 3:101002102-101002124 CATATGCAGAAGATTGAAACTGG - Intergenic
959080198 3:101792459-101792481 CATATGCAAAAAATTGAAACTGG - Intronic
959104418 3:102050206-102050228 CATATGCAGAAGATTAAAACTGG - Intergenic
959128353 3:102318992-102319014 CATATGCAGAAGATTTTAGCTGG - Intronic
959269419 3:104187815-104187837 CATTTGCAGAAGAATGAACCTGG - Intergenic
959291425 3:104479383-104479405 CATATGCAGAAGATTGAAACTGG + Intergenic
959326837 3:104947515-104947537 CATATGCAGAAGATTGAAACTGG - Intergenic
959680277 3:109088020-109088042 CATATGCAGAAGATTGAAGCGGG + Intronic
959788605 3:110330603-110330625 CATATGCAGAAGATTAAAGCGGG + Intergenic
959825203 3:110786099-110786121 CATTTGCAGAAGATTGAAACTGG - Intergenic
959870294 3:111319248-111319270 CATATGCAAAAGATTGAAACTGG + Intronic
960257648 3:115528189-115528211 CATATGCAAAAGAGTGAAACTGG - Intergenic
960560527 3:119078510-119078532 CATATGCAGAAGATTGAAGCTGG + Intronic
960721691 3:120630569-120630591 CATAAGCAGAAGATTTAAACTGG + Intronic
960855273 3:122096027-122096049 CATTTCCAAAATATGTAACCTGG + Intronic
960933053 3:122874084-122874106 CATAAGCAAAAGATTTATTGGGG - Intronic
961557204 3:127704172-127704194 CATATGCAGAAAATTTAAACTGG + Intronic
961932618 3:130549591-130549613 CATATGCAGAAGATTGAAACTGG - Intergenic
961938643 3:130613210-130613232 CATATGCAGAAGATTGAAACTGG - Intronic
961978595 3:131053136-131053158 CATTTACAAAAGATTCACTGAGG + Intronic
962001298 3:131300576-131300598 CATATGCAGAAGATTGAAACTGG - Intronic
962038285 3:131677628-131677650 CATATGCAGAAGATTGAAACTGG - Intronic
962047855 3:131779628-131779650 CATATGCAGAAGATTGAAACTGG + Intronic
962123677 3:132591201-132591223 CATATGCAGAAGATTGAAGCTGG - Intronic
962339878 3:134573447-134573469 CATATGCAGAAGATTGAAACTGG - Intronic
962391417 3:134975855-134975877 CATCTCCAGAAGATTTAATGTGG - Intronic
962478239 3:135776317-135776339 CATATGCAAAAGATTGAAACTGG + Intergenic
962655241 3:137537311-137537333 CATATGCAGAAGATTGAAACTGG - Intergenic
962723880 3:138202956-138202978 CTTTTGAAAAAAATTTATTCAGG - Intronic
962981562 3:140495660-140495682 CATATGCAAAAAATTGAAACTGG - Intronic
962997091 3:140640936-140640958 CATATGCAGAAGATTGAAGCTGG - Intergenic
963030317 3:140965951-140965973 AATTTTTAAAAGATTTTATCTGG + Intronic
963053323 3:141161349-141161371 CATATGCAGAAGATTGAAACTGG + Intergenic
963276444 3:143335705-143335727 CATATGCAAAAGAACTAATTTGG + Intronic
963477050 3:145820867-145820889 CATATGCAGAAGATTGAAACTGG - Intergenic
963594182 3:147304386-147304408 TATTTGCACAAGAATTGATCCGG + Intergenic
963692069 3:148517591-148517613 CATATGCAGAAGATTGAAACTGG - Intergenic
963694261 3:148544901-148544923 CATATGCAGAAGACTTAAACTGG + Intergenic
963703464 3:148655824-148655846 CATATGCAGAAGATTGAAACTGG - Intergenic
963979694 3:151523611-151523633 CATATGCAGAAGATTGAAGCCGG + Intergenic
964057560 3:152479834-152479856 CATATGCAAAAGAATGAAACTGG - Intergenic
964061643 3:152531936-152531958 CATTTGCCCATGTTTTAATCAGG + Intergenic
964061672 3:152532305-152532327 CATATGCAGAAGATTGAAACAGG - Intergenic
964375638 3:156046266-156046288 CATATGCATAAGATTGAAACGGG - Intronic
964462293 3:156947311-156947333 CAATTGGAAAAGAGTAAATCTGG - Intronic
964511426 3:157456568-157456590 CATATGCAGAAGATTAAAACTGG - Intronic
964837761 3:160958354-160958376 CATATGCAGAAGATTGAAACTGG - Intronic
964868340 3:161286486-161286508 CATATGCAGAAGATTGAAACTGG + Intergenic
965084542 3:164077966-164077988 CATATGCAAAAGATTGAAACTGG + Intergenic
965112415 3:164444760-164444782 CATATGCAGAAGATTGAAACTGG - Intergenic
965123216 3:164590561-164590583 CATATGCAAAAGATTGAAACTGG - Intergenic
965262104 3:166500479-166500501 CATATGCAGAAGATTGAAACTGG - Intergenic
965295441 3:166939597-166939619 CATATGCCAAAGATTAAAACTGG - Intergenic
965303591 3:167035962-167035984 CATATGCAGAAGATTGAAACTGG - Intergenic
965318188 3:167216916-167216938 CATATGCAGAAGATTGAAGCTGG + Intergenic
965466654 3:169038178-169038200 CATATGCAGAAGATTGAAACAGG + Intergenic
965726006 3:171716902-171716924 CATGTGCAGAAGATTGAAACTGG - Intronic
965963455 3:174456662-174456684 CATATGCATAAGATTGAAACTGG + Intronic
965965650 3:174485930-174485952 CATATGCAGAAGATTCAAACTGG - Intronic
965980722 3:174686736-174686758 CATTTGCAAAAGACTGAAACTGG + Intronic
966045806 3:175547360-175547382 CATATGCAGAAGATTAAAACTGG + Intronic
966145262 3:176804566-176804588 CATATGCAGAAGATTAAAACTGG + Intergenic
966235486 3:177697041-177697063 TATATGCAAAAGATTGAAACTGG - Intergenic
966299023 3:178458138-178458160 CATTTAAAAAAGATTTAGACTGG - Intronic
966337606 3:178886949-178886971 CATGTGCACAAGATTGAAACTGG + Intergenic
966500830 3:180636874-180636896 CATATGCAGAAGATTGAAACTGG + Intronic
966512005 3:180774971-180774993 CATATGCAGAAGATTAAAACTGG - Intronic
966566818 3:181391980-181392002 CATATGCAGAAGATTAAAACTGG - Intergenic
967122841 3:186399009-186399031 CATATGCAGAAGATTGAAACTGG - Intergenic
967255065 3:187582845-187582867 CATATGCAGAAGATTGAAACTGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967396120 3:189010960-189010982 CATATGCAGAAGATTGAAGCTGG - Intronic
967401068 3:189061240-189061262 CATATGCAGAAGATTGAAGCTGG + Intronic
967604021 3:191422849-191422871 CATATGCAGAAGATTGAAACTGG + Intergenic
967622064 3:191645539-191645561 CATACGCAAAAGATTTACACTGG + Intergenic
967637855 3:191825087-191825109 CATATGCAGAAGATTGAAACTGG + Intergenic
967750069 3:193103389-193103411 CATATGCAGAAGATTGAAACTGG - Intergenic
967944269 3:194790420-194790442 CATATGCAGAAGATTAAAACTGG - Intergenic
969835690 4:9838797-9838819 CATTTGCAGAAGATTGAAACTGG + Intronic
969908473 4:10420458-10420480 CATATGCAGAAGATTGAAACTGG - Intergenic
970082936 4:12309269-12309291 CATATGCAGAAGATTGAAACTGG - Intergenic
970166646 4:13244993-13245015 CCTTTGAAGAACATTTAATCTGG + Intergenic
970173450 4:13312217-13312239 CATATGCAGAAGATTGAAACTGG + Intergenic
970248212 4:14086222-14086244 CATATGCAGAAGATTGAAACTGG - Intergenic
970285038 4:14502855-14502877 CATATGCAGAAGATTGAAACTGG - Intergenic
970633194 4:17977574-17977596 CATTTGCAAAATTTTTAACTGGG + Intronic
970738489 4:19203263-19203285 CATATGCAAAAAATTGAAACTGG + Intergenic
970772113 4:19626317-19626339 CATATGCAGAAGATTCAAACTGG - Intergenic
970775919 4:19674176-19674198 CATATGCAGAAGATTGAAACTGG - Intergenic
970776567 4:19681527-19681549 ATTTTGCTAAATATTTAATCTGG - Intergenic
970986202 4:22161585-22161607 CATATGCAGAAGATTAAAACTGG + Intergenic
971107744 4:23545320-23545342 CATATGCAGAAGATTGAAACTGG + Intergenic
971558143 4:28039477-28039499 CATATGCAGAAGATTGAAACTGG + Intergenic
971572485 4:28231176-28231198 CATTTGGAAGAGATTCAAGCAGG + Intergenic
971657036 4:29361682-29361704 CATGAGCAAAAGATTTCAGCTGG - Intergenic
971706158 4:30046366-30046388 CATATGCAGAAGATTGAAACTGG + Intergenic
971754611 4:30691225-30691247 CATATGCAAAAGAATGAAGCTGG - Intergenic
971970246 4:33610182-33610204 CATATGCAGAAGATTAAAACTGG + Intergenic
972066833 4:34957301-34957323 CATTTGGAAAATAATTTATCTGG - Intergenic
972116133 4:35636479-35636501 CATATGCAAAAGCTTGAAACTGG + Intergenic
972136121 4:35896465-35896487 CATATGCAAAAGATTAAAACTGG + Intergenic
972205784 4:36771094-36771116 CATGTACAAAAGAATGAATCTGG - Intergenic
972214952 4:36886818-36886840 CATATGCAGAAGATTGAAACTGG - Intergenic
972241692 4:37200142-37200164 CATATGCAGAAGATTGAAGCTGG - Intergenic
972377279 4:38484669-38484691 CATATGCAGAAGATTGAAGCTGG - Intergenic
972651707 4:41024127-41024149 CATATGCAAAAGATTGAAGCTGG + Intronic
972830494 4:42809388-42809410 CATATGCAGAAGATTGAAACTGG - Intergenic
972853998 4:43083603-43083625 CATATGCAGAAGATTGAAACTGG - Intergenic
972933070 4:44099182-44099204 CATATGCAGAAGATCAAATCTGG - Intergenic
972976155 4:44638886-44638908 CATTTGCAGAAGAATTAAACTGG - Intronic
973001441 4:44956459-44956481 CATATGCAAAAGATTGAAACTGG - Intergenic
973058076 4:45685762-45685784 CATATGCAGAAAATTTAAACTGG + Intergenic
973143828 4:46800548-46800570 CATATGCAGAAGATTGAAACTGG + Intronic
973145915 4:46825824-46825846 CATATGCAGAAGATTGAAGCTGG + Intronic
973368080 4:49223705-49223727 CATTTGGAAAATTTGTAATCTGG - Intergenic
973392970 4:49571721-49571743 CATTTGGAAAATTTGTAATCTGG + Intergenic
974032167 4:56786110-56786132 CATATGCAGAAGATTGAAGCTGG - Intergenic
974184259 4:58426180-58426202 CATTTGCAGAAGACTGAAGCTGG - Intergenic
974248586 4:59355967-59355989 CATATGCAGAAGATTGAAGCTGG - Intergenic
974360775 4:60876286-60876308 CATATGCAGAAGATTGAAACTGG - Intergenic
974535170 4:63165243-63165265 CATATGCAGAAGATTGAAACTGG - Intergenic
974581549 4:63810059-63810081 CATATGCAGAAGATTAAAACTGG - Intergenic
974639023 4:64605706-64605728 CATATGCAAAAGAATAAAACTGG + Intergenic
974722919 4:65765334-65765356 CATATGCAGAAGATTAAAACTGG - Intergenic
974797452 4:66771237-66771259 CATGTGCAGAAGATTGAAACTGG - Intergenic
974826086 4:67132738-67132760 CATATGCAAAAGATTGAAACTGG + Intergenic
974834170 4:67227132-67227154 CATATGCACAAGATTGAAACTGG + Intergenic
974889030 4:67856425-67856447 CATTTGCAGAAGAATGAAACTGG + Intronic
974912185 4:68136195-68136217 CATGTGCAAAAGAATAAAACTGG + Intergenic
974922016 4:68253513-68253535 CATATGCAGAAGATTGAAGCTGG + Intergenic
974990543 4:69082498-69082520 CATGTGAAGAAGTTTTAATCTGG + Intronic
975193890 4:71500225-71500247 CTTTTGCAAAACATCTATTCAGG + Intronic
975299541 4:72774256-72774278 CATATGCAAAAGACTGAAGCTGG - Intergenic
975360844 4:73469859-73469881 CATATGCAGAAGATTGAAACTGG - Intergenic
975446152 4:74467924-74467946 CAATGGCCAAAGATTTAATCAGG + Intergenic
975478483 4:74850318-74850340 CATATGCAAAAGATTAAAACTGG - Intergenic
975481645 4:74887430-74887452 CACATGCAAAAGAATTAAACTGG + Intergenic
975898767 4:79124941-79124963 CATATGCAGAAGATTGAAACTGG - Intergenic
975901687 4:79161130-79161152 AATTTGCAAAAGAATGAAGCTGG - Intergenic
976001724 4:80382103-80382125 CATAGGCAAAAGATTGAAACTGG + Intronic
976015453 4:80547322-80547344 CATATGCAGAAGATTGAAACTGG + Intronic
976015913 4:80554188-80554210 CATATGCAGAAGATTGAAGCTGG - Intronic
976039566 4:80866785-80866807 TATTTGAAATAAATTTAATCAGG + Intronic
976076959 4:81310186-81310208 CATATGCAGAAGATTGAAACTGG + Intergenic
976355038 4:84107063-84107085 CATATGCAAAAGATCTATTTTGG + Intergenic
976481368 4:85550243-85550265 CATATGCAGAAGATTGAAACTGG - Intronic
976895172 4:90100567-90100589 CATTTCAAAAGGTTTTAATCAGG + Intergenic
977005551 4:91565096-91565118 CATATGCAGAAGATTGAAGCTGG - Intronic
977129023 4:93210280-93210302 CATATGCAGAAGATTGAAACTGG - Intronic
977505528 4:97898100-97898122 CATATGCCGAAGATTGAATCTGG - Intronic
977729756 4:100337020-100337042 CATATGCAGAAGATTGAAGCTGG + Intergenic
977752483 4:100626075-100626097 CATATGCAGAAGATTGAAACTGG + Intronic
977820001 4:101460074-101460096 CATATGCAGAAGATTGAAGCTGG + Intronic
977916610 4:102601410-102601432 CATTTGATATACATTTAATCTGG - Intronic
978006041 4:103618273-103618295 CATATGCAGAAGATTGAAGCTGG - Intronic
978076124 4:104532287-104532309 CTTTTGAAAAAAATTTAATGTGG + Intergenic
978271505 4:106895513-106895535 CATATGCAGAAGATTGAAACTGG + Intergenic
978338163 4:107691986-107692008 CATATGCAGAAGATTGAAACTGG + Intronic
978670507 4:111243257-111243279 CATTTGGAAAAGATAAAAACTGG + Intergenic
978693720 4:111549396-111549418 CATATGCAGAAGATTAAAGCTGG + Intergenic
978875019 4:113630260-113630282 CATTTGCAAAACCTCTGATCAGG - Intronic
978910209 4:114053611-114053633 CATATGCAGAAGATTGAAACTGG + Intergenic
978940456 4:114429664-114429686 CATATGCAGAAGATTGAAACTGG + Intergenic
978942443 4:114452957-114452979 CATATGCAGAAGATTGAAACTGG + Intergenic
979125012 4:116958702-116958724 CATTTGTAAAAGTTTGAATTTGG - Intergenic
979139001 4:117149199-117149221 CATATGCAGAAGATTAAAACTGG - Intergenic
979160426 4:117453007-117453029 CATATGCAGAAGATTGAAACTGG + Intergenic
979366620 4:119832459-119832481 CATTTGCAGAAGAATGAAACTGG - Intergenic
979565374 4:122148762-122148784 TATATGCAGAAGATTTAAGCTGG + Intergenic
979576430 4:122296864-122296886 CATATGCAGAAAATTTAAACTGG + Intronic
979968923 4:127110649-127110671 CATATGCAGAAGATTGAAACTGG + Intergenic
979988814 4:127349551-127349573 CATATGCAAAAGATTGAAGCTGG + Intergenic
979996600 4:127439025-127439047 CATATGCAAATGATTGAAGCTGG + Intergenic
980331658 4:131418302-131418324 CATATGCAGAAGATTAAAACTGG + Intergenic
980477471 4:133336093-133336115 CATATGCAGAAGATTGAAACCGG - Intergenic
980510761 4:133784758-133784780 CATTTGTAGCAGATTTAATGAGG + Intergenic
980531768 4:134065814-134065836 CAGGTGCAAAAGATTAAAACCGG - Intergenic
980540107 4:134182395-134182417 CATATGCAGAAGATTGAAACTGG + Intergenic
980549073 4:134309357-134309379 CATTGACAAAAGTTTTATTCAGG - Intergenic
980555506 4:134398328-134398350 CATCTGCAGAAGATTGAAACTGG - Intergenic
980647310 4:135658986-135659008 CATATGCAGAAGATTGAAGCTGG - Intergenic
980684944 4:136215265-136215287 CATATGCAGAAGATTAAAACTGG - Intergenic
980746893 4:137029782-137029804 CATATGAAGAAGATTGAATCTGG - Intergenic
980762544 4:137254812-137254834 CATGTGCAAAAGAATAAAACTGG - Intergenic
980824839 4:138060814-138060836 CATATGCAGAAGATTGAAACTGG - Intergenic
981174056 4:141659753-141659775 AATATGCAAGAGATTTAAACAGG + Intronic
981203137 4:142006955-142006977 CATTTGCAGAAGAATAAAGCTGG - Intergenic
981402288 4:144327410-144327432 CATATGCAGAAGATTGAAACTGG + Intergenic
981444190 4:144816613-144816635 CATATGCAGAAGAATTAAACTGG + Intergenic
981448017 4:144863081-144863103 CATATGCAGAAGATTGAAACTGG + Intergenic
981621580 4:146706139-146706161 CATATGCAAAAGAATGAAACTGG - Intergenic
981874976 4:149531083-149531105 CATGTGAAAAAGTTTTACTCAGG + Intergenic
981894967 4:149787633-149787655 CATATGCAGAAGAATGAATCTGG + Intergenic
982095076 4:151914404-151914426 CATATGCAAAAGAATGAAACTGG - Intergenic
982326247 4:154131510-154131532 CATATGCAAAAGAATGAAACTGG + Intergenic
982399943 4:154954924-154954946 AATTGGAAAAAGATTTAATTGGG - Intergenic
982432027 4:155333944-155333966 CATATGCAGAAGATTGAAACTGG + Intergenic
982499540 4:156135818-156135840 CATATGCAGAAGATTGAAACTGG + Intergenic
982810300 4:159817419-159817441 CATATGCAGAAGATTGAAACTGG + Intergenic
982931457 4:161412862-161412884 CATCTGCAGAAGATTGAAGCTGG + Intronic
982971597 4:161995080-161995102 CATATGCAGAAGATTGAAGCTGG - Intronic
983345008 4:166517752-166517774 CATGTGCAACAGAGTAAATCAGG + Intergenic
983487319 4:168347400-168347422 CATATGCAAAAGATTGAGCCTGG - Intergenic
983665237 4:170174121-170174143 CATATGCAAAAGAATTAAATTGG - Intergenic
983711393 4:170721099-170721121 CATATGCAGAAGATTGAAGCTGG + Intergenic
983952472 4:173658910-173658932 CATATGCAGAAGATTGAAACTGG + Intergenic
984023483 4:174515456-174515478 CATATGCAGAAGATTGAAACTGG + Intronic
984027825 4:174566057-174566079 CATATGCAGAAGATTGAAACTGG + Intergenic
984038085 4:174693354-174693376 GATATGCAAAAGATTGAAGCTGG - Intronic
984073243 4:175143279-175143301 CACATGCAAAAGAATTAAACTGG - Intergenic
984144042 4:176039475-176039497 CATATGCAAAAGATTGAAATTGG - Intergenic
984449149 4:179876908-179876930 CATATGCAGAAGATTAAAACTGG - Intergenic
984576036 4:181449352-181449374 AATTTGGAATAGATTTAATTTGG + Intergenic
985093518 4:186388907-186388929 CATATGCAAAAGATTGAAACTGG + Intergenic
985225422 4:187755135-187755157 CATATGCAGAAGATTAAAACTGG - Intergenic
1202765178 4_GL000008v2_random:143197-143219 CATTTGGAAAATTTGTAATCTGG - Intergenic
985623699 5:971897-971919 CATGTGCAGAAGATTGAAGCTGG + Intergenic
985839128 5:2292466-2292488 CATGTGCAGAAGATTGAAACTGG + Intergenic
986078443 5:4363043-4363065 CATTTGCAAAACATTCTATAAGG - Intergenic
986420196 5:7572828-7572850 CATATGCATAAGATTGAAACTGG - Intronic
986532273 5:8750626-8750648 CATCTGCAGAAGATTGAAACTGG - Intergenic
986822208 5:11480205-11480227 CATATGCAGAAGATTGAATCTGG - Intronic
986904134 5:12472766-12472788 CATATGCAGAAGATTTAAACGGG + Intergenic
986979631 5:13432292-13432314 CATATGCAGAAGATTGAAACTGG + Intergenic
987092398 5:14520046-14520068 CATATGCAGAAGATTGAAACTGG - Intronic
987572320 5:19680221-19680243 CATATGCAGAAGATTGAAACTGG + Intronic
987644654 5:20653004-20653026 CATATGCAGAAGATTGAAACTGG + Intergenic
987744927 5:21958490-21958512 CATATGCAAAAGATTGAAACTGG - Intronic
987850036 5:23339902-23339924 CATATGCAGAAGATTGAAGCTGG - Intergenic
987900761 5:24008672-24008694 CATATGCAGAAGATTGAAACTGG - Intronic
987994098 5:25252346-25252368 CATATGCAGAAGATTAAAACTGG + Intergenic
988128873 5:27078033-27078055 CATATGCAGAAGATTAAAGCTGG + Intronic
988340768 5:29968078-29968100 CATATGCATAAGATTGAAACTGG + Intergenic
988583121 5:32485644-32485666 CATATGCAAAAGATTGAAGTTGG - Intergenic
988587342 5:32518830-32518852 CATTTGCAGAAGAATCAAACTGG + Intergenic
988865418 5:35329287-35329309 CATATGCAGAAGATTGAAACTGG + Intergenic
988871003 5:35389722-35389744 CATATGCAGAAGATTGATTCTGG + Intergenic
989210174 5:38851388-38851410 CATGTGCAAGAGATTTACTGGGG + Intronic
989210461 5:38854193-38854215 CATTTGCATAAGACATCATCAGG + Intronic
989274302 5:39569137-39569159 CATCTCCAAAAGTTTCAATCAGG + Intergenic
989324128 5:40170661-40170683 CATATGCAAAAGAATGAACCTGG + Intergenic
989370780 5:40705269-40705291 CATATGCAGAAGATTGAAGCTGG + Intergenic
989447896 5:41552466-41552488 CATATGCAGAAGATTGAAACTGG + Intergenic
989455874 5:41643463-41643485 CATATGCAAAAGATTGAAACAGG + Intergenic
989526405 5:42458423-42458445 CATATGCAGAAGATTGAAGCTGG + Intronic
989555070 5:42784796-42784818 CATATGAAAAAGAATTAAACTGG - Intronic
989559386 5:42833810-42833832 CATATGCAAAAGATTGAAACTGG + Intronic
989652889 5:43713230-43713252 CATCTGTAAAATATATAATCAGG + Intergenic
989727181 5:44600284-44600306 CATATGCAGAAAATTTAAACTGG - Intergenic
989778363 5:45235692-45235714 CATATGCAGAAGATTAAAACTGG - Intergenic
989793125 5:45431630-45431652 CATGTGCAAAAGATTGAAACTGG - Intronic
990024176 5:51165154-51165176 CATATGCAGAAGATTGAAACTGG + Intergenic
990317733 5:54599780-54599802 CATTTGCAGAAAATTGAAACTGG + Intergenic
990434013 5:55769312-55769334 CATATGCAGAAGATTGAAACTGG - Intronic
990540313 5:56766061-56766083 CATTTGTAAAACATTTATTGTGG + Intergenic
990771448 5:59250972-59250994 CATATGCAGAAGATTGAAGCTGG + Intronic
990854997 5:60255158-60255180 GATTAGAAAAAGATTTAACCAGG + Intronic
991177053 5:63701255-63701277 CATATGCAGAAGATTGAAACTGG + Intergenic
991238194 5:64423790-64423812 CATATGCAGAAGATTGAACCTGG + Intergenic
991765136 5:69968619-69968641 CATATGCAAAAGATTGAAACTGG - Intergenic
991782189 5:70149534-70149556 CATATGCAAAAGATTGAAACTGG + Intergenic
991844368 5:70843690-70843712 CATATGCAAAAGATTGAAACTGG - Intergenic
991874632 5:71149849-71149871 CATATGCAAAAGATTGAAACTGG + Intergenic
992032434 5:72735487-72735509 CATATGCAAAAGACTGAAACTGG - Intergenic
992040402 5:72825232-72825254 AATTTGCGAAAGGTTTATTCTGG - Intronic
992305481 5:75432894-75432916 CATATGCAGAAGATTGAAACTGG - Intronic
992337778 5:75790922-75790944 CATATGCAGAAGATTGAAACTGG - Intergenic
992345716 5:75875375-75875397 CATGTGCAGAAGATTGAAGCTGG + Intergenic
993135687 5:83958988-83959010 CAATTACAAGAGATTTAATGTGG + Intronic
993178034 5:84513925-84513947 CATATGCAGAAGATTAAAACTGG - Intergenic
993311720 5:86340496-86340518 CATATGCAGAAGATTGAAACTGG + Intergenic
993313803 5:86373680-86373702 CATGTGCAAAAGATTAAAACTGG + Intergenic
993365132 5:87025896-87025918 CATATGCAAAAAATTGAAACTGG - Intergenic
993637444 5:90362184-90362206 CATATGCAAAAGATTGAAACTGG + Intergenic
993797487 5:92285305-92285327 CATATGCAGAAGATTCAAACTGG + Intergenic
993821378 5:92621236-92621258 CATATGCAGAAGATTGAAACAGG - Intergenic
993833718 5:92790320-92790342 CATATGCAGAAGATGTAAACTGG - Intergenic
993894760 5:93521163-93521185 CATATGCAGAAGATTGAAGCTGG + Intergenic
993944461 5:94100732-94100754 CATATGCAGAAGACTGAATCTGG + Intronic
994119543 5:96098519-96098541 CATATGCAGAAGATTGAAACTGG - Intergenic
994129302 5:96206500-96206522 CATATGCAGAAGATTGAAACTGG - Intergenic
994228485 5:97283801-97283823 CATATGCAGAAGATTGAAGCTGG - Intergenic
994257720 5:97619404-97619426 CATATGCAGAAGATTAAAACTGG - Intergenic
994262345 5:97674858-97674880 CATATGCAGAAGATTGAAACTGG - Intergenic
994263492 5:97686925-97686947 CATATGCAGAAGATTTAAACTGG + Intergenic
994293160 5:98054331-98054353 CATATGCAAAAGAATGAAACTGG + Intergenic
994303860 5:98179346-98179368 CATATGCAGAAGATTGAAACTGG + Intergenic
994422937 5:99544947-99544969 CATATGCAGAAGATTGAAACTGG - Intergenic
994429106 5:99633060-99633082 CATATGCAGAAGATTAAAACTGG - Intergenic
994503526 5:100610277-100610299 CATATGCAGAAGATTGAAACTGG - Intergenic
994588062 5:101736555-101736577 CATTTGCAAAAGATTGAAGCTGG + Intergenic
994709355 5:103247809-103247831 CATATGCAGAAGATTGAAACTGG - Intergenic
994848066 5:105016084-105016106 CATATGCAGAAGATTGAAACTGG + Intergenic
995329251 5:110928705-110928727 CATTTGCAGAAAATTGAAACTGG - Intergenic
995429320 5:112056672-112056694 CATATGCAGAAGATTAAAGCTGG + Intergenic
995682502 5:114735794-114735816 CATATGCAGAAGATTGAAACTGG - Intergenic
995718070 5:115100207-115100229 CATGTGCAGAAGATTGAAGCTGG - Intergenic
995919482 5:117294375-117294397 CATATGCAGAAGGTTTAAACTGG - Intergenic
995951028 5:117714159-117714181 CATATGCAAAAGATTGAAATTGG + Intergenic
995958702 5:117812618-117812640 CAATTTCTTAAGATTTAATCAGG + Intergenic
996036699 5:118766370-118766392 CATATGCAAAAGATTGAAACTGG + Intergenic
996248002 5:121288810-121288832 CATATGCAGAAGATTGAAACTGG - Intergenic
996265882 5:121539452-121539474 CATATGCAGAAGATTGAAACTGG + Intergenic
996269930 5:121591703-121591725 CATATGCAGAAGATTGAAACTGG + Intergenic
996273609 5:121638551-121638573 CTTATGCAAAAAATTTAAACAGG - Intergenic
996318327 5:122186608-122186630 CATATGAAAAAGATTGAAACTGG - Intergenic
996599234 5:125242595-125242617 CATATGCCAAAGATTTAAACTGG - Intergenic
996679726 5:126218834-126218856 CATATGCAGAAGATTGAAACTGG + Intergenic
996681330 5:126230428-126230450 CATATGCAGAAGATTGAAGCAGG + Intergenic
996784265 5:127221499-127221521 CATATGCAAAGGATTGAAACTGG + Intergenic
996857999 5:128031418-128031440 CATATGCAAAAGAATGAAGCTGG + Intergenic
996951862 5:129136481-129136503 CATATGCAGAAGATTGAAACTGG + Intergenic
996991212 5:129634692-129634714 CATATGCAGAAGATTGAAACTGG + Intronic
997769196 5:136538340-136538362 CATATGCAAATGATTGAAACTGG - Intergenic
997802542 5:136879963-136879985 CATATGCAAAAGAGTGAAACTGG + Intergenic
998275474 5:140748607-140748629 CATATGCAAAAGATTGAAACTGG - Intergenic
998714338 5:144865361-144865383 AATTTGCAAAAGATTTTTTTTGG + Intergenic
998714359 5:144865709-144865731 AATTTGCAAAAGATTTTTTTTGG + Intergenic
998778091 5:145625974-145625996 CATATGCAGAAGATTGAAACTGG + Intronic
999041989 5:148424422-148424444 CAATAGCAGAATATTTAATCAGG - Intronic
999055952 5:148576764-148576786 CATATGCAGAAGATTGAAGCTGG + Intronic
999070983 5:148743552-148743574 CATGTGCAGAAGATTAAAACTGG + Intergenic
999553544 5:152716748-152716770 CTTTTTGAAAAGATTTATTCTGG - Intergenic
999615958 5:153424606-153424628 CATATGCAGAAGATTGAAACTGG + Intergenic
999851771 5:155548269-155548291 CATATGCAGAAGATTGAAACTGG - Intergenic
999985515 5:157001103-157001125 CATTTGCAGAAAATTGAAACTGG + Intergenic
1000435822 5:161207450-161207472 CATATGCAAAGGATTGAAACTGG + Intergenic
1000472030 5:161655453-161655475 CATATGCAGAAAATTGAATCTGG + Intronic
1000732014 5:164846535-164846557 CATATGCAGAAGATTAAAACTGG - Intergenic
1000768702 5:165323333-165323355 CATTTGAAAAACATGTAATCAGG + Intergenic
1000804256 5:165769290-165769312 CATTTGCAAAATATATGAACTGG + Intergenic
1001046566 5:168377224-168377246 CATATGCAAAAGAATAAAACTGG + Intronic
1001844439 5:174909331-174909353 CATATGCAAAAAATTAAAACTGG + Intergenic
1001851034 5:174965641-174965663 CAGATGCAAAAGATTGAAACTGG - Intergenic
1001860852 5:175053572-175053594 CATTTGCAAAGGAGTTTTTCTGG - Intergenic
1003200235 6:3952956-3952978 CATATGCAAAAGATTGAAACTGG - Intergenic
1003738976 6:8912980-8913002 CATATGCAGAAGATTGAAACTGG + Intergenic
1003826111 6:9954093-9954115 CATTTGCAGAAGACTGAAACTGG - Intronic
1003976388 6:11348718-11348740 CATTTACAGAAGATTGAAACTGG + Intronic
1003992971 6:11505816-11505838 CATATGCAGAAGATTGAAACTGG + Intergenic
1004131287 6:12922117-12922139 CATTTGCAGAACATTGAATGGGG + Intronic
1004611523 6:17245672-17245694 CATATGCAGAAGATTGAAACTGG + Intergenic
1004614182 6:17274329-17274351 CATATGCAAAAGGTTGAAACTGG + Intergenic
1004836696 6:19539104-19539126 CATTTACAAAATATTTATTGGGG - Intergenic
1004922794 6:20392668-20392690 CTTGTGCCAAAGAGTTAATCAGG - Intergenic
1005110454 6:22275914-22275936 CATATGCAAAAGAATGAAACTGG - Intergenic
1006203376 6:32317252-32317274 CATATGCAGAAGATTGAAGCTGG + Intronic
1006251272 6:32788100-32788122 CATATGCAGAAGATTGAAACTGG + Intergenic
1006327323 6:33364376-33364398 CATTTGCAAAACTTTTATTTAGG - Intergenic
1007206365 6:40154944-40154966 CATGTGCAAAAGATTAAAGCTGG - Intergenic
1007288659 6:40767430-40767452 CATATGCAGAAGATTGAAACTGG - Intergenic
1007438577 6:41837400-41837422 CATATGCAGAAGATTGAAGCTGG + Intronic
1007504493 6:42324696-42324718 CATATGCAGAAGATTAAAACTGG + Intronic
1007888618 6:45262455-45262477 CATATGCAGAAGATTGAACCTGG + Intronic
1007972930 6:46071020-46071042 CATATGCAGAAGATTGAAACTGG + Intronic
1008049139 6:46882314-46882336 AATGTGCAAAAAATTTACTCAGG + Intronic
1008204540 6:48638454-48638476 CATATGCAGAAGATTAAAACTGG + Intergenic
1008234005 6:49021809-49021831 CATATGCAGAAGATTTAAATTGG - Intergenic
1008237809 6:49071217-49071239 CCTTTGAAAAAAATTTAATCTGG - Intergenic
1008736688 6:54553148-54553170 GATTTGCAGAAGAATTAACCTGG + Intergenic
1008737543 6:54564221-54564243 CATATGCAGAAGATTGAAACTGG + Intergenic
1008779441 6:55085166-55085188 CATGTGCAGAAGATTGAAACTGG + Intergenic
1008972983 6:57391560-57391582 CATATGCAGAAGATTGAAGCTGG - Intronic
1009037570 6:58136084-58136106 CATATGCACAAGATTGAAACTGG + Intergenic
1009192848 6:60650401-60650423 TATTTTCAAAGGACTTAATCTGG - Intergenic
1009213357 6:60889712-60889734 CATATGCACAAGATTGAAACTGG + Intergenic
1009265661 6:61551560-61551582 CATATGCAGAAGATTGAAACTGG - Intergenic
1009467147 6:63985724-63985746 CATATGCAGAAGATTGAAGCTGG + Intronic
1009553658 6:65133566-65133588 TATATGCAAAAGATTGAAACTGG + Intronic
1009641194 6:66339034-66339056 TATTTTCAAAATAATTAATCAGG + Intergenic
1009645082 6:66391232-66391254 CATTTGCAAAAGAAGTTATAAGG + Intergenic
1009689924 6:67016909-67016931 CATATGCAAAAGAATGAAACTGG - Intergenic
1009700442 6:67171027-67171049 CATATGCAGAAGAATAAATCTGG + Intergenic
1009864047 6:69374443-69374465 CAGTGGCAAAATATTTAAGCTGG - Intronic
1009871179 6:69453534-69453556 CATATGCAGAAGATTGAAACTGG - Intergenic
1009882960 6:69592105-69592127 CATATGCAGAAGATTAAAACTGG - Intergenic
1009915630 6:69992097-69992119 CATATGCAGAAGATTGAAACTGG - Intronic
1010006018 6:70996285-70996307 GATTTGGAAAACAGTTAATCAGG - Intergenic
1010023202 6:71185458-71185480 CATATGCAGAAGATTGAAGCTGG + Intergenic
1010143070 6:72633829-72633851 CATATGCAGAAGAATTAAACTGG + Intronic
1010207780 6:73338323-73338345 CATTTTCAACAGATTTACTGAGG - Intergenic
1010295371 6:74189943-74189965 CATATGCAGAAGATTGAAACTGG - Intergenic
1010322753 6:74531846-74531868 CATATGCAGAAGATTGAAGCTGG + Intergenic
1010330436 6:74617314-74617336 CATATGCAGAAGATTGAAACTGG + Intergenic
1010377281 6:75185911-75185933 CATACGCAAAAGACTGAATCTGG + Intronic
1010459362 6:76096750-76096772 CATATGCAGAAGATTGAAACTGG + Intergenic
1010473168 6:76254304-76254326 CATATGCAAAAGAATTAAACTGG - Intergenic
1010665788 6:78628944-78628966 TATTTACAAAAGATTGAAACTGG - Intergenic
1010675026 6:78733117-78733139 CATATGCAGAAGATTGAAACTGG + Intergenic
1010682761 6:78816393-78816415 CATATGCAGAAGATTGAAACTGG + Intergenic
1010708163 6:79139002-79139024 CATTTGCAGAAGATTGAAACTGG + Intergenic
1010820904 6:80414484-80414506 CATATGCAAAAGATTAAAACTGG - Intergenic
1010878859 6:81143068-81143090 CATATGCAGAAGATTGAATCTGG + Intergenic
1010956841 6:82100046-82100068 CATATGCAGAAGATTGAAACTGG + Intergenic
1010993605 6:82507456-82507478 CATATGCAGAAGATTTGAACTGG + Intergenic
1011102114 6:83734199-83734221 CATATGCAGAAGATTAAAACTGG - Intergenic
1011253489 6:85397735-85397757 CATATGCAGAAGATTAAAACTGG + Intergenic
1011324264 6:86131708-86131730 CATATGCAAAAGATTAAAACTGG - Intergenic
1011392736 6:86872421-86872443 CATATGCAGAAGATTGAAGCTGG + Intergenic
1011500875 6:87988326-87988348 CATATGCAGAAGATTGAAACTGG + Intergenic
1011524703 6:88251761-88251783 CATATGCAAAACATTGAATTTGG + Intergenic
1011584956 6:88914582-88914604 CATATGCAGAAGAATTAAACTGG + Intronic
1011985707 6:93442172-93442194 CATATGCAAAAAAATAAATCTGG - Intergenic
1012008078 6:93742066-93742088 CATATGCAGAAGATTGAAACTGG + Intergenic
1012096503 6:94969205-94969227 AATATGCAAAAGATTGAAACTGG + Intergenic
1012155100 6:95809529-95809551 CATATGCAGATGATTTAAACTGG - Intergenic
1012308262 6:97687218-97687240 CATATGCAGAAGATTGAAACTGG + Intergenic
1012337598 6:98080324-98080346 CATATGCAGAAGATTTAAGCTGG - Intergenic
1012352736 6:98272899-98272921 CATCTGCAAGAGATTTTATTAGG - Intergenic
1012371267 6:98510237-98510259 CACTTGCAAAAAATAAAATCAGG + Intergenic
1012592834 6:101004072-101004094 CATATGCAGAAGATTGAAGCTGG - Intergenic
1012722887 6:102769484-102769506 CATATGCAAAAGACTGAAGCTGG + Intergenic
1012727288 6:102830715-102830737 CATATGCAGAAGATTGAAACTGG - Intergenic
1012834476 6:104247794-104247816 CATTTGCAGAAGATTGAAACTGG + Intergenic
1012984829 6:105864669-105864691 CATTTGTAAAAGACTAAAACTGG - Intergenic
1013393303 6:109709158-109709180 CATATGCAGAAGATTGAAACTGG - Intronic
1013572840 6:111447179-111447201 GGTTTGCAAAAGACTTAATACGG + Intronic
1013573385 6:111453241-111453263 AATTTGCAAAATAATTTATCTGG - Intronic
1013881149 6:114902487-114902509 CATATGCAGAAGATTGAAACTGG - Intergenic
1013905439 6:115211543-115211565 CATTTGCAGAAGAGTAAAACTGG + Intergenic
1013991639 6:116260679-116260701 CATATGCAAAAGAGTGAAACTGG - Intronic
1014039572 6:116810460-116810482 GAATAGCAAAAAATTTAATCTGG - Intronic
1014179490 6:118369370-118369392 CATATGCAGAAAATTTAAACGGG + Intergenic
1014334917 6:120121324-120121346 CATTTGCAGAAGAATGAAACTGG - Intergenic
1014374040 6:120649984-120650006 CATATGCAGAAGATTGAAGCTGG + Intergenic
1014516317 6:122383061-122383083 CATATGCAGAAGATTGAAACTGG - Intergenic
1014567138 6:122963281-122963303 CATATGCAGAAGATTAAAACTGG + Intergenic
1014613842 6:123578329-123578351 CATATGCAGAAGATTGAAACTGG - Intronic
1014860159 6:126456498-126456520 CATATGCAGAAGATTGAAACTGG + Intergenic
1015395789 6:132732981-132733003 CATATGCAGAAGATTGAAACTGG + Intronic
1015493965 6:133860625-133860647 CATATGCAGAAGATTGAAGCTGG - Intergenic
1015658161 6:135543279-135543301 CATATGCAGAAGATTGAAGCTGG + Intergenic
1015697713 6:136000446-136000468 CATGTGCAGAAGATTAAAACTGG - Intronic
1016095183 6:140028330-140028352 CATATGCAGAAGATTGAATTTGG - Intergenic
1016287809 6:142492584-142492606 CATATGCAGAAGATTGAAACTGG + Intergenic
1016288594 6:142502853-142502875 CATATGCAGAAGATTGAAACTGG - Intergenic
1016344458 6:143097422-143097444 CATTTGAAAAATCTATAATCCGG + Intronic
1016473042 6:144395359-144395381 CATTTGCAACACATATAATATGG + Intronic
1016498703 6:144693089-144693111 CATATGCAAAACATTGAAACTGG - Intronic
1016538959 6:145141429-145141451 CATTTGCAATAAATAAAATCAGG + Intergenic
1016586460 6:145692615-145692637 CATATGCAGAAGATTGAAACTGG - Intronic
1016867934 6:148787385-148787407 CATATGCAAAAAATTGAAACTGG - Intronic
1017216865 6:151918296-151918318 CACTTGCATGAGATTTAACCAGG - Intronic
1017614105 6:156226661-156226683 CATGGGCAAAAGATTTAAATAGG + Intergenic
1018239347 6:161757479-161757501 TATGTGCAAAAGATTTTAACAGG + Intronic
1018636871 6:165869890-165869912 CATATGCAAAAGAATAAAACTGG + Intronic
1018661833 6:166094988-166095010 CATATGCAGAAGATTAAAACTGG - Intergenic
1018722657 6:166584896-166584918 CATTAGCTAAAGATTCAATCTGG + Intronic
1019031130 6:169013498-169013520 CATATGCAGAAGATTGAAACTGG - Intergenic
1020289171 7:6709656-6709678 CATTTCCAAAACATTTGATTTGG - Intergenic
1020331718 7:7024360-7024382 CATATGCAGAAGATTGAAGCTGG - Intergenic
1020512478 7:9075182-9075204 CATTTGCAGAAAATTGAAACTGG - Intergenic
1020592812 7:10164578-10164600 CATTTGCTAAAGAATAAATCAGG - Intergenic
1020606998 7:10351704-10351726 CATATGCAGAAGATTAAAACTGG - Intergenic
1020702725 7:11503256-11503278 CATATGCAGAAGATTGAAGCTGG + Intronic
1020974783 7:14991382-14991404 CATATGCAGAAGATTGAAACTGG + Intergenic
1021004797 7:15380977-15380999 CATATGCAGAAGATTCAAACTGG + Intronic
1021129610 7:16895847-16895869 CATATGCAAAAAATTGAATTTGG - Intergenic
1021350760 7:19591196-19591218 CATATGCAGAAGATTGAAACTGG - Intergenic
1021419360 7:20427872-20427894 CATATGCAGAAGATTGAAACTGG + Intergenic
1021426044 7:20500763-20500785 CATATGCAGAAGATTGAAACTGG + Intergenic
1021754521 7:23838569-23838591 CATATGCAGAAGATTAAAACTGG + Intergenic
1021837793 7:24697376-24697398 GGTTTGAAAAAGATTTAATGAGG - Intergenic
1021976491 7:26016070-26016092 CATATGCAGAAGATTGAAGCTGG - Intergenic
1022285358 7:28951762-28951784 CATATGCAGAAGATTGAAACTGG + Intergenic
1022370613 7:29767783-29767805 CATATGCAGAAGATTGAAACTGG + Intergenic
1022431518 7:30327343-30327365 CATATGCAGAAGATTGAAACTGG - Intronic
1022435868 7:30384554-30384576 CATGTGCAAAAGATTAAAGTGGG - Intronic
1022669691 7:32444197-32444219 CATATGCAGAAGATTGAAACTGG + Intergenic
1022762972 7:33377242-33377264 AATATGCAAAAGATTGAAACTGG - Intronic
1022764553 7:33396448-33396470 CATTTGCAAAAAATTGAAAATGG + Intronic
1023232174 7:38045371-38045393 CATATGAAAAAGAATTAAACTGG - Intergenic
1023234826 7:38074036-38074058 CATATGCAGAAGACTGAATCTGG - Intergenic
1023488169 7:40709351-40709373 CATGTGCACAGGATTTAATGAGG + Intronic
1023555088 7:41413613-41413635 CATATGCAGAAGATTGAAGCTGG - Intergenic
1023657752 7:42442499-42442521 CATATGCAGAAGATTGAAACTGG - Intergenic
1023885813 7:44354727-44354749 CATATGCAAAAGATTGAAACTGG - Intergenic
1024127027 7:46309650-46309672 CATATGCAGAAGATTGAAACTGG - Intergenic
1024340748 7:48256493-48256515 CATGTGCAGAAGATTGAAGCTGG - Intronic
1024344917 7:48303530-48303552 CATGTGCAGAAGATTGAAACTGG - Intronic
1024398894 7:48900560-48900582 CATTTTCAAATGTTTTAATTTGG - Intergenic
1024765260 7:52650142-52650164 CATATGCAGAAGAATTAATCTGG + Intergenic
1024831000 7:53457115-53457137 CATTTGCTGATTATTTAATCTGG - Intergenic
1024853524 7:53749144-53749166 CATATGCAGAAGATTAAAGCTGG + Intergenic
1025715090 7:63948411-63948433 CATATGCAGAAGATTGAAACTGG + Intergenic
1026581197 7:71619007-71619029 CATATGCAGAAGATTGAAGCTGG - Intronic
1026795270 7:73362331-73362353 AATTTGAAAAAGATGTAATGGGG - Intergenic
1027343021 7:77229514-77229536 CATATGCAGAAGATTGAAACTGG - Intronic
1027541604 7:79473692-79473714 CATATGCAAAAGATTGAAGCTGG - Intergenic
1027627049 7:80559146-80559168 CATATGCAGAAGATTGAAACTGG - Intronic
1027688609 7:81311246-81311268 CATATGCAGAAGATTGAAACTGG + Intergenic
1027739857 7:81987704-81987726 CAATGGAAATAGATTTAATCTGG + Intronic
1028138944 7:87250937-87250959 GATGTGCAAAAGTTTTAATTTGG + Intergenic
1028218205 7:88161264-88161286 CATATGCAGAAGATTGAAACTGG + Intronic
1028278294 7:88887468-88887490 CATATGCAGAAGATTAAAGCTGG - Intronic
1028353074 7:89873295-89873317 CATATGCAGAAGATTAAAACTGG - Intergenic
1028609208 7:92690315-92690337 CATATGCAGAAGATTGAAACTGG - Intronic
1028780863 7:94734791-94734813 CGTATGCAAAAGATTGAAACTGG + Intergenic
1028885663 7:95929729-95929751 CATTTGTAGAAAATTTAATAAGG - Intronic
1029867300 7:103647996-103648018 CATTTGCAGAAGAATGAAACTGG + Intronic
1030200512 7:106898575-106898597 CATATGCAGAAGATTGAAGCTGG - Intronic
1030430093 7:109434537-109434559 CATATGCAGAAGATTGAAACTGG - Intergenic
1030718261 7:112836663-112836685 CATATGCAGAAGATTGAAACTGG - Intronic
1030754949 7:113275960-113275982 CATATGCAAAAGAATGAAACTGG + Intergenic
1030808887 7:113951002-113951024 CATATGCAGAAGATTAAAACTGG - Intronic
1031052723 7:116961007-116961029 CATATGCAAAAGATTGAAAGTGG - Intronic
1031182335 7:118434115-118434137 CATATGCAAAAGATTGAAACAGG - Intergenic
1031224005 7:119011126-119011148 CATATGCAGAAGATTTAAGCTGG + Intergenic
1031224116 7:119012437-119012459 CACATGCAGAAGATTTAAACTGG + Intergenic
1031291399 7:119941229-119941251 AATTTGCCAAAGATTTTCTCTGG + Intergenic
1031348717 7:120701745-120701767 CATGTGCAGAAGATTGAAACTGG + Intronic
1031736155 7:125364644-125364666 TATTTGCAGAAGATTGAAACTGG - Intergenic
1031891638 7:127300941-127300963 CATATGCAGAAGATTGAATCTGG + Intergenic
1031909624 7:127501716-127501738 CATATGCAGAAGATTGAAACAGG + Intergenic
1031911378 7:127520249-127520271 CATATGCAGAAGATTGAAACTGG + Intergenic
1031942231 7:127801377-127801399 AATTGGCAAAAGATATAAACAGG - Intronic
1032242079 7:130170507-130170529 CAAATGAAAAAGATTCAATCTGG + Intronic
1032249791 7:130245812-130245834 CATATGCAGAAGATTGAAACTGG + Intergenic
1032618890 7:133506998-133507020 CATTTAGATAAGATTTAATTTGG + Intronic
1033034263 7:137858007-137858029 CATATGCAAAAGAATGAATTTGG + Intergenic
1033070824 7:138200642-138200664 CATATGCATAAGAATGAATCTGG + Intergenic
1033393502 7:140951062-140951084 CATATGCAAAAGAATGAATTTGG + Intergenic
1033723918 7:144092048-144092070 CATATGCAGAAGATTGAAACTGG - Intergenic
1033957398 7:146868216-146868238 CATATGGAAAAGATTGAAGCTGG - Intronic
1034389503 7:150773939-150773961 CATATGCAGAAGATTGAAACCGG + Intergenic
1034743501 7:153500574-153500596 CATTTGCAGAAAATTAAAACTGG - Intergenic
1034864679 7:154630998-154631020 CATTTTCAAAATATTGAATTTGG + Intronic
1035103761 7:156423794-156423816 CATATGCCAAAGAATTAAACTGG - Intergenic
1035453455 7:158994087-158994109 CATATGCAGAAGATTGAAACTGG + Intergenic
1035645787 8:1218284-1218306 CATATGCAGAAGATTGAAACTGG - Intergenic
1036103496 8:5814138-5814160 CATGTGCAGAAGATTGAAACTGG + Intergenic
1036453428 8:8889405-8889427 CAATTACAAAAGATTTTCTCTGG + Intronic
1036633980 8:10535512-10535534 CATATGCAGAAGATTGAAACTGG + Intronic
1037027909 8:14062057-14062079 CATATGCAGAAGATTGAAACTGG - Intergenic
1037698092 8:21245445-21245467 CATTTGGAGAAGACTTGATCAGG + Intergenic
1038196334 8:25371624-25371646 GAATTGCAAAAGATATAAACTGG - Intronic
1038233108 8:25724137-25724159 CATATGCAGAAGATTGAAACTGG - Intergenic
1038282206 8:26175860-26175882 CATATGCAGAAGATTGAAGCTGG + Intergenic
1038731504 8:30132152-30132174 CATTGGCAAAGGAGTGAATCAGG + Exonic
1039066797 8:33615986-33616008 CATTTAAAAAAGAATTAATGTGG - Intergenic
1039268176 8:35851235-35851257 CATGTACAAAAGATTGAATCTGG - Intergenic
1039289696 8:36080805-36080827 CATATGCAGAAGATTGAAACTGG + Intergenic
1039632350 8:39125858-39125880 CATATGCAAAAAATTTAAACTGG - Intronic
1040557606 8:48495177-48495199 CATTTTCAAAAGAATGAATTTGG + Intergenic
1040826752 8:51630229-51630251 CATATGCAGAAGATTAAAACTGG + Intronic
1040966738 8:53089755-53089777 CATATGCAGAAGATTTAAACTGG - Intergenic
1041069120 8:54109565-54109587 CACTTGCAAAAGAATGAAACTGG - Intergenic
1041521502 8:58761880-58761902 CATATGCAGAAGATTAAAGCTGG - Intergenic
1041571980 8:59347850-59347872 CATATGCAGAAGATTGAAACTGG + Intergenic
1042006585 8:64186636-64186658 CATATGCAGAAGATTGAAACTGG + Intergenic
1042330445 8:67574682-67574704 CATATGCAAAAGAATAAATTTGG + Intronic
1042629254 8:70798744-70798766 CATGTGCAAAAGATTGAAGCTGG - Intergenic
1042752461 8:72172952-72172974 CATATGCAGAATATTAAATCTGG - Intergenic
1042854130 8:73248136-73248158 CATATGCAGAAGATTAAAACTGG - Intronic
1042871299 8:73402185-73402207 CATCTGCAGAAGATTGAAACTGG + Intergenic
1043107384 8:76131894-76131916 CATATGCAGAAGATTGAAACTGG - Intergenic
1043133928 8:76497554-76497576 CATATGCAGAAGATTGAAACTGG + Intergenic
1043250086 8:78061430-78061452 CATATGCAGAAGATTGAAACTGG + Intergenic
1043329753 8:79100957-79100979 CATATGCAGAAGATTGAAACTGG - Intergenic
1043675122 8:82941759-82941781 CATATGCATAAGATTGAAACCGG + Intergenic
1043696233 8:83221975-83221997 CATATGCAGAAGAATAAATCTGG + Intergenic
1043732259 8:83697174-83697196 CATATGCAGAAGATTGAAACTGG - Intergenic
1043754966 8:83991789-83991811 CATATGCAGAAGATTGAAGCTGG + Intergenic
1043805230 8:84664012-84664034 CATATGCAGAAGATTGAAACTGG - Intronic
1043806115 8:84673574-84673596 CATATGCAGAAGATTAAAACTGG - Intronic
1043808787 8:84708099-84708121 CATTATCCAAAGATTTAATATGG + Intronic
1043817820 8:84824807-84824829 CATATGCAGAAGAATGAATCTGG + Intronic
1043951556 8:86315076-86315098 CATATGCAGAAGATTGAAACTGG - Intronic
1044126322 8:88462129-88462151 CATATGCAGAAGACTGAATCTGG - Intergenic
1044242893 8:89907459-89907481 CATATGCAGAAGATCTAAACTGG - Intronic
1044508137 8:93044722-93044744 CATATGCAGAAAATTGAATCTGG - Intergenic
1044772941 8:95656422-95656444 CATATGCAGAAGATTGAAGCTGG - Intergenic
1044802680 8:95973351-95973373 CATATGCAGAAGATTGAAACTGG + Intergenic
1044910837 8:97056575-97056597 CATTAGCAAAAAATTTAAAGTGG - Intronic
1044914009 8:97092616-97092638 CATATGCAGAAGATTGAAACTGG + Intronic
1045592819 8:103617305-103617327 CATATGCAGAAGATTGAAGCTGG + Intronic
1045610026 8:103828761-103828783 CATATGCAGAAGATTGAATCTGG - Intronic
1045676165 8:104610086-104610108 CATATGCAGAAGATTGAAACTGG - Intronic
1045865534 8:106861126-106861148 CATATGCAGAAGATTGAAACTGG - Intergenic
1045952820 8:107870857-107870879 CATATGCAGAAGATTGAAACTGG + Intergenic
1045963059 8:107991346-107991368 TATATGCAAAAGATTGAAACTGG + Intronic
1046179229 8:110621235-110621257 CATATGCAGAAGATTGAAACTGG + Intergenic
1046188807 8:110762187-110762209 CATGTGCAGAAGATTGAAGCTGG + Intergenic
1046333239 8:112749480-112749502 CATATGCAGAAGATTGAAGCTGG + Intronic
1046405230 8:113764167-113764189 TATTTCCGAAAGATTTTATCAGG - Intergenic
1046458424 8:114501346-114501368 CATATGCAGAAGATTGAAACTGG - Intergenic
1046558000 8:115800409-115800431 AATGTGCAAAAGATTTGAACAGG + Intronic
1046709285 8:117491570-117491592 CATTTGCAAAAAACTGAAACTGG + Intergenic
1046709489 8:117494071-117494093 CATATGCAGAAGATTGAAGCTGG - Intergenic
1046895579 8:119468437-119468459 CATATGCAGAAGATTGAAACTGG + Intergenic
1046942605 8:119945528-119945550 CATTTGCTAAAGAGTGATTCTGG + Intronic
1046977843 8:120302437-120302459 CATATGCAGAAGATTGAAACTGG - Intronic
1046989016 8:120428288-120428310 CATATGCAGAAGATTGAAACTGG + Intronic
1047119706 8:121887545-121887567 CATTTGCAGAAGAATAAAACTGG - Intergenic
1047147355 8:122218236-122218258 CATGTGCAAAAGAATGAAACTGG + Intergenic
1047159182 8:122357583-122357605 CATATGCAAAAGATTGAAACTGG - Intergenic
1047541648 8:125772846-125772868 CTTTGACAAAAGTTTTAATCTGG - Intergenic
1047575233 8:126146078-126146100 CATATGCAGAAGATTGAAGCTGG - Intergenic
1047700004 8:127439842-127439864 CATATGCAGAAGATTGAAGCTGG + Intergenic
1047872436 8:129099084-129099106 CATTTCCAAAAGTTTTAATGTGG + Intergenic
1048425686 8:134321200-134321222 CATATGCAGAAGATTGAAACTGG - Intergenic
1048435954 8:134417777-134417799 CATATGCAGAAGATTGAAACTGG + Intergenic
1048727668 8:137405254-137405276 CATATGCAGAAGATTGAAACTGG + Intergenic
1050003655 9:1104841-1104863 CATATGCAGAAGATTAAAACTGG - Intergenic
1050037434 9:1451976-1451998 CATTTGCAGAAAATTGAAACTGG - Intergenic
1050041377 9:1497495-1497517 CATATGCAAAATAATTATTCAGG + Intergenic
1050239089 9:3615230-3615252 CATATGCAAAATATTAAAACTGG - Intergenic
1050249043 9:3724407-3724429 CATATGCAAAAGATTTAAACTGG + Intergenic
1050286799 9:4111487-4111509 CATTTGGTAAAGGTTTAATTTGG - Intronic
1050475468 9:6035688-6035710 CATATGCACAAGATTGAAACTGG + Intergenic
1050617054 9:7412461-7412483 CATATGCAGAAGATTGAATCTGG + Intergenic
1050617563 9:7418240-7418262 CATATGCAGAAGATTGAATTCGG + Intergenic
1050675407 9:8047048-8047070 CATAGGCAAAAGATTGAAACTGG - Intergenic
1050685804 9:8168108-8168130 AATGTGCAAAAGATATAAACAGG + Intergenic
1051040106 9:12798683-12798705 TATTTGCAAACTATTTAATCTGG + Intronic
1051102208 9:13534617-13534639 CATACGCAGAAGATTTAAACTGG - Intergenic
1051320033 9:15893228-15893250 CATATGCAAAATATTGAAACTGG + Intronic
1051498706 9:17753874-17753896 CATATGCAGAAGATTGAAACTGG - Intronic
1051538164 9:18183175-18183197 CACATGCAAAAAATTAAATCTGG + Intergenic
1051899248 9:22021071-22021093 CATATGCAGAAGATTAAATCTGG - Intronic
1052064348 9:23998421-23998443 CATTTGCAGAAGAATGAAACTGG + Intergenic
1052180833 9:25525477-25525499 CATATGCAAAAGATTAAAAGTGG - Intergenic
1052286692 9:26794263-26794285 CATGTGCAGAAGATTGAAACTGG + Intergenic
1052483584 9:29065464-29065486 CATATGCAGAAGATTGAAACTGG - Intergenic
1052620108 9:30897914-30897936 CATTTGGAAAGGATTCAATACGG + Intergenic
1052694498 9:31858792-31858814 CATATGCAGAAGATTGAAACTGG + Intergenic
1052779981 9:32771649-32771671 CATATGCAGAAGATTGAAGCTGG - Intergenic
1052793156 9:32896675-32896697 CATATGCAGAAGATTGAAACTGG - Intergenic
1052805508 9:33009861-33009883 CATTGGTAAAGGATTTAAGCAGG - Intronic
1052885482 9:33643630-33643652 CATTTGCAGAAAATTGAAACTGG + Intergenic
1052902897 9:33809873-33809895 CATATGCAAAAGATTGAAACTGG + Intergenic
1053215992 9:36270994-36271016 CCTTTTAAGAAGATTTAATCAGG - Intronic
1053548631 9:39051012-39051034 CATATGCAGAAGATTGAAACTGG + Intergenic
1053812749 9:41871068-41871090 CATATGCAGAAGATTGAAACTGG + Intergenic
1054617846 9:67316371-67316393 CATATGCAGAAGATTGAAACTGG - Intergenic
1054932353 9:70648788-70648810 CACATGCAAAAGATTGAAACTGG + Intronic
1055015856 9:71617168-71617190 CATATGCAGAAGATTGAAACTGG + Intergenic
1055273515 9:74588103-74588125 AATTTTCAAAATATTTAATAAGG + Intronic
1055337271 9:75245726-75245748 CATATGCAGAAGATTGAAACTGG - Intergenic
1055365296 9:75537773-75537795 TATATGCAAAAGATTGAAACTGG - Intergenic
1055523277 9:77104154-77104176 CATATGCAGAAGATTGAAACTGG + Intergenic
1055624039 9:78154704-78154726 CATATGCAGAAGATTGAAACTGG + Intergenic
1055831365 9:80382683-80382705 CATTTTCAAAAGCTTAATTCTGG - Intergenic
1055833706 9:80414385-80414407 CATGTGCAGAAGATTAAAACTGG - Intergenic
1055869437 9:80856285-80856307 CATATGCAGAAGATTGAATCTGG - Intergenic
1056079730 9:83079248-83079270 CATATGCAGAAGATTAAAGCTGG - Intergenic
1056117437 9:83454527-83454549 CTTTTGCAAACGATGTATTCTGG + Intronic
1056127474 9:83550146-83550168 CATATGCAGAAGATTGAAGCTGG - Intergenic
1056141777 9:83688377-83688399 CATATGAAAAATAGTTAATCTGG - Intronic
1056360426 9:85852349-85852371 CACATGCAAAAGAATAAATCTGG - Intergenic
1056936871 9:90921701-90921723 CATTTTAAAAAGATTTATTTTGG - Intergenic
1057638152 9:96790827-96790849 CATATGCAGAAGATTGAAGCTGG - Intergenic
1057689961 9:97275173-97275195 CATATGCAGAAGATTGAAACTGG - Intergenic
1057697179 9:97332094-97332116 CATATGCAGAAGATTGAAACTGG - Intronic
1058016189 9:100035018-100035040 CATATGCAAAAGAATGAAACTGG + Intronic
1058087441 9:100764085-100764107 CATATGCAGAAGATTGAAGCTGG - Intergenic
1058236088 9:102491755-102491777 CATATGCAAAAGAATGAAACTGG + Intergenic
1058289614 9:103222694-103222716 CATATGCAAAAGATTGAAACTGG + Intergenic
1058403397 9:104642863-104642885 CATATGCAGAAGATTGAAACTGG + Intergenic
1058408217 9:104701316-104701338 GATTAGTAAAAGATTTAAACAGG + Intergenic
1058670039 9:107353472-107353494 CATATGCAGAAAATTTAAACTGG - Intergenic
1059036471 9:110759275-110759297 CATATGTAAAAGATTGAAGCTGG + Intronic
1059062372 9:111046631-111046653 CATATGCAGAAGATTGAAACTGG + Intergenic
1059385187 9:113958954-113958976 CATTTACAAAAGAGTTTCTCAGG - Intronic
1059649557 9:116303099-116303121 CATTTGTAAAAGATTAGATCTGG + Intronic
1059743286 9:117176051-117176073 AATATGCAAAAGATATAATCAGG + Intronic
1059778615 9:117502667-117502689 CATCTGCAGAAGATTTAAACTGG - Intergenic
1059901970 9:118937859-118937881 CATATGCAAAAGATTGAAGCTGG - Intergenic
1060037428 9:120267949-120267971 CATATGCAAAAGAATGAAACTGG + Intergenic
1060336983 9:122734068-122734090 CATATGCAAAAGATTGAAACTGG + Intergenic
1060448318 9:123712850-123712872 TATTTCCAACAGATTTAATCTGG + Intronic
1060752105 9:126177462-126177484 CATATGCAAAAGAATGAAACTGG - Intergenic
1060885249 9:127147574-127147596 CATATGCAGAAGATTAAAGCTGG - Intronic
1061526385 9:131167720-131167742 AATGAGCAAAAGATTTAATTCGG - Intronic
1061616476 9:131783289-131783311 CATATGCAGAAGATTGAAACTGG - Intergenic
1061684487 9:132264045-132264067 CATTTGCAAAAGCTTTCAGAGGG - Exonic
1061701804 9:132421926-132421948 CATTTGCAAAATGTTTATTGAGG + Intronic
1061741796 9:132712092-132712114 CATATGCAAAAGAATGAAGCTGG + Intergenic
1203545926 Un_KI270743v1:128086-128108 CATTTGGAAAATTTGTAATCTGG - Intergenic
1185913269 X:4005929-4005951 CATTTGGAAAATATTTATTGGGG + Intergenic
1185996319 X:4953927-4953949 CATATGCAGAAGATTGAAGCTGG + Intergenic
1186051412 X:5599777-5599799 CATATGCACAAGATTAAAACTGG - Intergenic
1186372695 X:8963833-8963855 CATATGAAGAAGATTTAAACTGG + Intergenic
1186579432 X:10801643-10801665 CATATGCAAAAGAATGAAACTGG + Intronic
1186605728 X:11088793-11088815 CATATGCAGAAGATTGAAGCTGG + Intergenic
1186834660 X:13425657-13425679 AATGGGCAAAAGATTTAAACAGG - Intergenic
1187344949 X:18454804-18454826 CATTTTCAAATGATATAATGAGG - Intronic
1187713969 X:22083129-22083151 CATATGCAGAAGATTGAAACTGG + Intronic
1187945373 X:24421455-24421477 CATATGCAGAAGATTGAAACTGG - Intergenic
1188014370 X:25091825-25091847 CATATGCAGAAGATTGAAGCTGG - Intergenic
1188027290 X:25223506-25223528 CATATGCAGAAGATTGAAGCTGG - Intergenic
1188035212 X:25309987-25310009 CATATGCAGAAGATTGAAACTGG - Intergenic
1188064290 X:25638749-25638771 CATATGCAAAAGAATGAAACTGG + Intergenic
1188080812 X:25838061-25838083 CATATGCAGAAGATTGAAACTGG + Intergenic
1188148766 X:26646925-26646947 CATATGCAGAAGATTGAAACTGG - Intergenic
1188155317 X:26734846-26734868 CATATGCAGAAGATTGAAACTGG - Intergenic
1188172652 X:26947066-26947088 CATATGCAGAAGATTGAAACTGG - Intergenic
1188319354 X:28716471-28716493 CATATGCAGAAGATTGAAACTGG + Intronic
1188723656 X:33552874-33552896 CATATGCATAAGATTGAAACTGG + Intergenic
1188743620 X:33815688-33815710 CATATGGACAAGATTTAAACTGG - Intergenic
1188754073 X:33938566-33938588 AATGTGCAAAAGGTTAAATCTGG - Intergenic
1188758459 X:33994979-33995001 CATATGCAGAAGATTGAAACTGG - Intergenic
1188804635 X:34571612-34571634 CATATGCAGAAGATTGAAGCTGG - Intergenic
1188806555 X:34597649-34597671 CATATGCAGAAGATTGAAACTGG - Intergenic
1188930952 X:36110309-36110331 CATATGCAGAAGATTGAAACTGG - Intronic
1188952900 X:36398492-36398514 CATATGCAGAAGATTAAAACTGG - Intergenic
1188982707 X:36741661-36741683 CATATGCAAAAGATTGAAGCTGG - Intergenic
1189190703 X:39100954-39100976 CATGTGCAGAAGATTGAACCTGG - Intergenic
1189210964 X:39281786-39281808 CATATGCAAAAGATTGAAACTGG + Intergenic
1189560963 X:42191196-42191218 CATTTGCAAAGGCTTTAAGGTGG + Intergenic
1189581237 X:42408897-42408919 CATATGCAGAAAATTTAAACTGG - Intergenic
1189584078 X:42439650-42439672 CATATGCAAAAGATTGAAACTGG + Intergenic
1189598608 X:42596741-42596763 CATATGCAAAAGAATGAAACTGG + Intergenic
1189652579 X:43206173-43206195 CATATGCAAAGGATTAAAACTGG - Intergenic
1189659448 X:43281018-43281040 CATATGCAGAAGATTGAAGCTGG - Intergenic
1189678807 X:43492294-43492316 CATATGCAGAAGATTGAAACTGG + Intergenic
1189752241 X:44234101-44234123 AATATGCAAGAGATTTAATAGGG - Intronic
1189806373 X:44739476-44739498 CATATGCAGAAGATTGAAACTGG - Intergenic
1189866966 X:45340561-45340583 CATATGCAAAAGATTGAAACTGG + Intergenic
1189872910 X:45403614-45403636 CATATGCAGAAGATTGAAACTGG + Intergenic
1189881600 X:45499349-45499371 CATATGCACAAGATTGAAACTGG - Intergenic
1189899225 X:45688690-45688712 CATATGCAGAAGATTGAAACTGG - Intergenic
1189899538 X:45691763-45691785 CATATGCAGAAGATTGAAACTGG + Intergenic
1190958199 X:55218253-55218275 CTTATGCAAAAGATTGAAACTGG - Intronic
1190965197 X:55293238-55293260 TATATGCAAAAGATTGAAACTGG - Intergenic
1191001791 X:55667650-55667672 CATATGCAGAAGATTGAAACTGG + Intergenic
1191603569 X:63037453-63037475 CATATACAGAAGAGTTAATCTGG - Intergenic
1191651764 X:63546280-63546302 CATATGCAGAAGATTGAAACTGG + Intergenic
1191747508 X:64505794-64505816 CATATGCAGAAGATTAAAACTGG + Intergenic
1191749444 X:64525944-64525966 CATATGCAGAAGATTGAAACTGG + Intergenic
1191818809 X:65279514-65279536 CATATGCAGAAGATTTAAGCTGG + Intergenic
1191894550 X:65978220-65978242 CATATGCAGAAGATTGAAACTGG - Intergenic
1192284120 X:69716264-69716286 CATATGCAAAAGATTGAAACTGG - Intronic
1192296562 X:69855511-69855533 CATATGCAGAAGATTGAAACTGG - Intronic
1192627691 X:72747198-72747220 CACTTGCAGAAAATTGAATCTGG - Intergenic
1192654017 X:72973614-72973636 CACTTGCAGAAAATTGAATCTGG + Intergenic
1192689463 X:73347117-73347139 CATATGCAGAAGATTGAAACTGG - Intergenic
1192696895 X:73426202-73426224 CATATGCAGAAGATTGAATCTGG + Intergenic
1192708300 X:73551411-73551433 CATATGCAGAAGATTGAATCTGG + Intergenic
1192710127 X:73573140-73573162 CATATGCAGAAGAATTAAGCTGG - Intronic
1192742659 X:73908386-73908408 CATATGCAGAAGATTGAAACTGG - Intergenic
1192837606 X:74818417-74818439 CATGTGCAGAAGATTAAAACTGG + Intronic
1192849407 X:74938743-74938765 CATATGCAAAGGATTGAAGCTGG - Intergenic
1192886745 X:75343270-75343292 CATATGCAGAAGATTGAAACTGG - Intergenic
1192961203 X:76132732-76132754 CATATGCAGAAAATTTAAACTGG + Intergenic
1192980755 X:76338004-76338026 CATATGCAGAAGAATAAATCTGG + Intergenic
1193053994 X:77130141-77130163 CATATGCAGAAGATTGAAACTGG + Intergenic
1193090407 X:77487970-77487992 CATATGCAGAAGATTGAAACTGG + Intergenic
1193165807 X:78278904-78278926 CATATGCAGAAGATTGAATCTGG + Intronic
1193173220 X:78360804-78360826 CATATGCAGAAGATTGAAACTGG + Intergenic
1193258190 X:79375066-79375088 CATATGCAGAATATTTAAACTGG - Intergenic
1193283146 X:79679663-79679685 CATATGCAGAACATATAATCTGG + Intergenic
1193299509 X:79872753-79872775 CATAAGCAAAAGATTGAAGCTGG + Intergenic
1193310913 X:80009663-80009685 CATATGCAGAAGATTGAAACTGG - Intergenic
1193359692 X:80566497-80566519 CATATGCAGAAGATTGAAACTGG - Intergenic
1193417887 X:81246503-81246525 CATATGCAGAAGATTGAATCTGG - Intronic
1193433014 X:81435377-81435399 CATATGCAGAAGATTGAAGCTGG - Intergenic
1193440091 X:81529960-81529982 CATATACAAAAGATTGAAACTGG - Intergenic
1193455940 X:81731355-81731377 CATATGCATAAGATTGAAACTGG + Intergenic
1193481023 X:82029375-82029397 CATGTGCAAAAGAATAAAACTGG + Intergenic
1193492880 X:82170883-82170905 CATATGCAGAAGATTGAAACAGG + Intergenic
1193493751 X:82185122-82185144 CATATGAAAAAGAATAAATCTGG - Intergenic
1193611273 X:83634319-83634341 CATATGCAGAAGATTGAAACAGG - Intergenic
1193635004 X:83939159-83939181 CATATGCAAAAGATTGAAACTGG - Intergenic
1193642212 X:84023839-84023861 CATATGCAGAAGATTAAAGCTGG - Intergenic
1193687676 X:84597893-84597915 CATATGCAGAAGATTTAAACTGG + Intergenic
1193752335 X:85361406-85361428 CATATGCAGAAGATTGAAACTGG - Intronic
1193754366 X:85388979-85389001 CATATGCATAAGATTGAAACTGG + Intergenic
1193767339 X:85546013-85546035 CATATGCAGAAGATTGAAACTGG - Intergenic
1193898992 X:87151923-87151945 CATATGCAGAAGATTTAAACTGG - Intergenic
1193970880 X:88050707-88050729 CATATGCAGAAGATTGAACCTGG + Intergenic
1194014599 X:88603736-88603758 CATATGCAGAAGATTGAAACAGG - Intergenic
1194042389 X:88957726-88957748 TATTTGCAAAATATTTTTTCCGG - Intergenic
1194055125 X:89122475-89122497 CATATGCAGAAGATTGAAACTGG - Intergenic
1194064985 X:89250372-89250394 CATATGCAAAAGAATTAAACTGG - Intergenic
1194101639 X:89712739-89712761 CATATGCAGAAGATTGAAACTGG - Intergenic
1194145025 X:90251702-90251724 CATATGCAGAAGATTAAAACTGG + Intergenic
1194201959 X:90962958-90962980 CATGTGCAGAAGATTGAAACTGG + Intergenic
1194217111 X:91144281-91144303 CATATGCAGAAGATTGAAACTGG - Intergenic
1194220233 X:91181262-91181284 CACATGCAGAAGATTTAAACTGG - Intergenic
1194226454 X:91265720-91265742 CATATGCAGAAGATTGAAACTGG - Intergenic
1194235454 X:91378117-91378139 CATCTGCAGAAGATTAAAACTGG + Intergenic
1194310224 X:92297343-92297365 CATATGCAGAAGATTGAAACTGG - Intronic
1194322757 X:92472299-92472321 CATATGCAGAAGATTGAAACTGG - Intronic
1194355847 X:92882858-92882880 CATATGCAGAAGATTGAAACTGG + Intergenic
1194424066 X:93715498-93715520 CATTTGTAACAGATGTAATAGGG - Intergenic
1194465571 X:94230881-94230903 CATATGCAGAAGATTGAAACTGG - Intergenic
1194484124 X:94466030-94466052 CATATGCAAAAGATTGAAGCTGG + Intergenic
1194542584 X:95192295-95192317 CATATGCAGAAGATTGAAACTGG - Intergenic
1194559333 X:95401538-95401560 CATATGCAAAACATTGAAACTGG + Intergenic
1194664344 X:96660950-96660972 CATATGCAAAAGATTGAAACTGG + Intergenic
1194710251 X:97227554-97227576 TGATTGCAAAAGATTTAATCAGG + Intronic
1194734746 X:97498819-97498841 CATTTTTAAAAGATGTAATGTGG + Intronic
1194786593 X:98092497-98092519 CATATGCAGAAGATTGAAACTGG - Intergenic
1194847898 X:98834518-98834540 CATATGCAAAAGATTAAAACTGG - Intergenic
1194918224 X:99730743-99730765 CATATGCAGAAGATTAAAACTGG + Intergenic
1194940153 X:99999402-99999424 GATTTGCAATAGATTTATTGAGG + Intergenic
1195142265 X:101973753-101973775 CATATGCAGAAGATTGAAACTGG - Intergenic
1195160874 X:102169730-102169752 CATATGCAGAAGATTGAAACTGG - Intergenic
1195250654 X:103042303-103042325 CATTTGCAGAAGAATAAAACTGG - Intergenic
1195270571 X:103225242-103225264 CATATGCAGAAGATTGAAACTGG + Intergenic
1195499333 X:105576353-105576375 CATATGCAGAAGATTGAAACTGG - Intronic
1195532902 X:105977657-105977679 CATATGCAGAAGATTGAAACTGG - Intergenic
1195540942 X:106062208-106062230 CATATGCAGAAGATTGAAACTGG - Intergenic
1195541884 X:106071587-106071609 CATATGCAGAAGATTGAAGCTGG - Intergenic
1195714080 X:107801453-107801475 CATGTGCAAAAGAATAAATTTGG + Intergenic
1195869625 X:109472585-109472607 AATTAGCTAAAGATTTGATCCGG + Intronic
1195960457 X:110380885-110380907 CATATGCAGAAGATTGAAACTGG + Intronic
1196537481 X:116864491-116864513 CATATGCAAAAAATTGAAACTGG - Intergenic
1196637774 X:118023078-118023100 CACTTGCAAAAGAATGAAACTGG - Intronic
1196642597 X:118080075-118080097 CATATGCAAAAGAATGAAACTGG + Intronic
1196933150 X:120701664-120701686 CATATGCAGAAGATTGAAGCTGG + Intergenic
1196982102 X:121226166-121226188 CATATGCAGAAGATTGAAACTGG - Intergenic
1197031113 X:121817353-121817375 CATATTCAGAAGATTTAAACTGG - Intergenic
1197094796 X:122580935-122580957 CATATGCAGAAGATTGAAACTGG + Intergenic
1197158695 X:123298923-123298945 CATATGCAGAAGATTGAAACTGG - Intronic
1197168520 X:123406011-123406033 CAACTGCAAAAGAATTAATATGG + Intronic
1197256637 X:124270321-124270343 CCTTTGAAAAAGATGTATTCTGG - Intronic
1197377606 X:125700927-125700949 CATATGCAGAAGATTGAAACTGG - Intergenic
1197395015 X:125916786-125916808 CATATGCAGAAGATTAAAACTGG - Intergenic
1197422294 X:126253220-126253242 CATTTGCAGAAGATTGAAATTGG - Intergenic
1197433116 X:126390953-126390975 CATATGTAGAAGATTTAAACTGG + Intergenic
1197499242 X:127223379-127223401 CATATGCAGAAGATTTAAACTGG - Intergenic
1197518120 X:127461970-127461992 CATATGCAGAAGATTGAAACTGG + Intergenic
1197532988 X:127653571-127653593 CATATGCAGAAGATTGAAACTGG + Intergenic
1197562628 X:128042839-128042861 CATATGCAGAAGATTAAAACTGG - Intergenic
1197562737 X:128044342-128044364 CACTCTCCAAAGATTTAATCAGG - Intergenic
1197603178 X:128555087-128555109 CATATGTAAAAGATTAAACCTGG + Intergenic
1197642553 X:128982979-128983001 CATATGCAGAAGATTGAAACTGG + Intergenic
1197684410 X:129424015-129424037 CATATGCAGAAGAATTAACCTGG - Intergenic
1197792027 X:130265391-130265413 CATATGTAAAAGATATAATATGG + Intronic
1197926289 X:131649918-131649940 CATATGCAGAAGATTGAAACTGG - Intergenic
1197950144 X:131886084-131886106 CATATGCAGAAGATTGAAACTGG - Intergenic
1198068523 X:133124398-133124420 CATATGCAGAAGATTGAAACTGG - Intergenic
1198076673 X:133200094-133200116 CATATGCAGAAGATTGAAGCTGG - Intergenic
1198132127 X:133706142-133706164 CATATGCAAAAGATTGAAACTGG + Intronic
1198451572 X:136771524-136771546 CATATGCAAAAGAATGAATTTGG + Intronic
1198551212 X:137747209-137747231 CTTTTTCAAAATATTTAATATGG - Intergenic
1198592210 X:138196513-138196535 CATATGCAAAAGAATGAATTTGG - Intergenic
1198728841 X:139705508-139705530 CATATGCAGAAGATTGAAGCTGG + Intronic
1198769581 X:140115419-140115441 CATGTGCAGAAGATTGAAACTGG - Intergenic
1198842153 X:140869021-140869043 CATCTGCAGAAGATTGAAACTGG + Intergenic
1198842251 X:140870338-140870360 CATATGCAAAAGAATGAAACTGG + Intergenic
1198885286 X:141328628-141328650 CATATGCAGAAGATTGAAACTGG + Intergenic
1198895299 X:141447784-141447806 CATATGCAGAAGATTGAAACTGG - Intergenic
1198915428 X:141665863-141665885 CATATGCAGAAGAATTAAACTGG - Intronic
1199116167 X:143995779-143995801 CATATGCAGAAGATTCAACCTGG + Intergenic
1199120889 X:144052645-144052667 CATATGCAGAAGATTGAAACTGG + Intergenic
1199146718 X:144377644-144377666 CATATGCAGAAGATTGAAACTGG - Intergenic
1199204715 X:145135429-145135451 CATATGCAGAAGATTGAAACTGG + Intergenic
1199224165 X:145353327-145353349 CATATGCAGAAGATTGAAACTGG + Intergenic
1199269662 X:145868199-145868221 CATATGCAGAAGATTGAACCTGG - Intergenic
1199271984 X:145894898-145894920 CATATACATAAGATTTAATATGG - Intergenic
1199306617 X:146274571-146274593 CATATGCAGAAGATTGAATCTGG - Intergenic
1199364573 X:146965304-146965326 CATATGCAAAAGAATGAAACTGG + Intergenic
1199375413 X:147102178-147102200 CATATGCAGAAGATTGAAACTGG + Intergenic
1199479152 X:148278658-148278680 CATATGCAGAAGATTGAAACTGG + Intergenic
1199488724 X:148375664-148375686 CATGTGCAGAAGATTGAAGCTGG + Intergenic
1199547600 X:149022897-149022919 CATATGCAGAAGATTAAAACCGG + Intergenic
1199563695 X:149191663-149191685 CATATGCAGAAAATTTAAACTGG - Intergenic
1199588898 X:149447320-149447342 CATATGCAGAAAATTTAAACTGG - Intergenic
1199642241 X:149873806-149873828 CATATGCAGAAGATTAAAACTGG + Intergenic
1199748005 X:150787421-150787443 CATATGCAGAAGATTGAAGCTGG - Intronic
1199857265 X:151770027-151770049 CATATGCAAAAAATTGAAACTGG + Intergenic
1199945656 X:152664527-152664549 CATATGCAAAAGAATGAAACTGG - Intergenic
1200035465 X:153325768-153325790 CATATGCAGAAGATTGAAGCTGG - Intergenic
1200237251 X:154473617-154473639 CATTTCCCCAACATTTAATCAGG - Exonic
1200358407 X:155576801-155576823 CATATGCAGAAGATTAAAACTGG + Intronic
1200454586 Y:3373825-3373847 CATATGCAGAAGATTGAAACTGG - Intergenic
1200490786 Y:3820996-3821018 CATATGCAGAAGATTAAAACTGG + Intergenic
1200547795 Y:4538410-4538432 CATATGCAGAAGATTGAAACTGG + Intergenic
1200553628 Y:4608073-4608095 CATATGCAGAAGATTGAAACTGG - Intergenic
1200556748 Y:4645014-4645036 CACATGCAGAAGATTTAAACTGG - Intergenic
1200618515 Y:5411630-5411652 CATATGCAGAAGATTGAAACTGG - Intronic
1200630913 Y:5585776-5585798 CATATGCAGAAGATTGAAACTGG - Intronic
1200664194 Y:5999839-5999861 CATATGCAGAAGATTGAAACTGG + Intergenic
1200719161 Y:6584454-6584476 CATATGCAAAAGAATTAAACTGG - Intergenic
1200942668 Y:8801980-8802002 CATATGCAGAAGAATTAAACTGG - Intergenic
1201349185 Y:13020516-13020538 CATATGCAGAAGATTGAAGCTGG - Intergenic
1201399426 Y:13588169-13588191 CATATGCAGAAGATTGAAACTGG + Intergenic
1201944857 Y:19500958-19500980 CATTTGATAAGGATTAAATCTGG - Intergenic
1202591180 Y:26485111-26485133 CATATGCAGAAGATTGAAACTGG - Intergenic