ID: 1086665033

View in Genome Browser
Species Human (GRCh38)
Location 11:89469904-89469926
Sequence AGTTGTTATTCCTTAGGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086665029_1086665033 26 Left 1086665029 11:89469855-89469877 CCTGATGGGCTATTTTAAAATAA 0: 1
1: 0
2: 3
3: 40
4: 369
Right 1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 212
1086665030_1086665033 2 Left 1086665030 11:89469879-89469901 CCACTTTCTACTACCAAACTTCT 0: 1
1: 0
2: 0
3: 19
4: 296
Right 1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086665033 Original CRISPR AGTTGTTATTCCTTAGGTCT CGG Intronic
900320302 1:2080178-2080200 AGTTTTTCTTCCTTTGGTCTTGG + Intronic
905533206 1:38698612-38698634 AGTTCTGATTCCCTTGGTCTGGG - Intergenic
905588469 1:39141314-39141336 AGTTCTGATTCAGTAGGTCTGGG + Intronic
906728086 1:48058538-48058560 AGTTACTATTCATTAGGCCTTGG + Intergenic
908699885 1:66887452-66887474 ATTTTTTATTCAGTAGGTCTGGG + Intronic
910154405 1:84197447-84197469 CTTTTTTATTCCTTGGGTCTAGG + Intronic
913439783 1:118885185-118885207 AGTTGGTATTCCTGAGATCAGGG + Exonic
917299223 1:173555515-173555537 GGTTGTGATTCTGTAGGTCTAGG + Intronic
917667026 1:177235169-177235191 GATTTTCATTCCTTAGGTCTGGG - Intronic
921193804 1:212732958-212732980 TCTTGGTATTCCTCAGGTCTGGG + Intronic
922519811 1:226240009-226240031 AGTAGTTCCTCCCTAGGTCTAGG - Intronic
923006864 1:230057225-230057247 AGTTCTGATTCAGTAGGTCTGGG + Intergenic
923631517 1:235651691-235651713 GTTTCTGATTCCTTAGGTCTGGG - Intergenic
923776671 1:236984790-236984812 ATTTGTTGTTGCTTAGGGCTAGG + Intergenic
1068849697 10:61722869-61722891 AGTTTTTCTTCCATAGGTATTGG - Intronic
1071237969 10:83671461-83671483 AGTTCATATTCCCTACGTCTGGG + Intergenic
1072094383 10:92162745-92162767 ATCTGTTATTCCTTATGACTTGG + Intronic
1072585054 10:96774166-96774188 AGGGGTTTTACCTTAGGTCTGGG + Intergenic
1072658915 10:97350383-97350405 AGTTGCTATGCCATAGCTCTTGG - Intergenic
1074982805 10:118633315-118633337 AGATGTTATTCCTTAGAACTTGG - Intergenic
1077587084 11:3462102-3462124 AATTCTGATTCATTAGGTCTGGG - Intergenic
1078536184 11:12176357-12176379 AGTTGTTATCTCATAGGGCTGGG + Intronic
1079557458 11:21777788-21777810 AGTTTTTATTCCTTAAGTACAGG - Intergenic
1079995815 11:27293993-27294015 AATTCTGATTCCATAGGTCTGGG - Intergenic
1080280307 11:30549550-30549572 AGTTGATATTCCTGAGTTATAGG - Intronic
1080873102 11:36253972-36253994 AGTTCTGATTCAGTAGGTCTGGG + Intergenic
1081187934 11:40067886-40067908 AGTTTTGATTCAGTAGGTCTGGG - Intergenic
1083533450 11:63446798-63446820 AGTTCTTATTCCACAGGTCAAGG - Intergenic
1084243079 11:67836114-67836136 AATTCTGATTCATTAGGTCTGGG - Intergenic
1084829911 11:71760828-71760850 AATTCTGATTCATTAGGTCTGGG + Intergenic
1086665033 11:89469904-89469926 AGTTGTTATTCCTTAGGTCTCGG + Intronic
1086788205 11:90999375-90999397 AGTTGGTATTCCTGAGTTTTTGG - Intergenic
1087835291 11:102868015-102868037 ATTGGCCATTCCTTAGGTCTTGG - Exonic
1088001707 11:104889587-104889609 ATTTCTTATTCAGTAGGTCTGGG - Intergenic
1090091776 11:123704293-123704315 ATTTATTATTTCTTAGTTCTAGG - Intergenic
1090250261 11:125246013-125246035 GGTTCTTCTTCCTGAGGTCTGGG - Intronic
1092413325 12:8270849-8270871 AATTCTGATTCATTAGGTCTGGG - Intergenic
1093312967 12:17614671-17614693 GTTTGTGATTCTTTAGGTCTTGG + Intergenic
1094012631 12:25825314-25825336 AGATGTTATCTCTTATGTCTAGG - Intergenic
1094596967 12:31874626-31874648 AGTTGTTTTTCGCTAGGTCTGGG + Intergenic
1095727736 12:45471422-45471444 CCTTTTTATTCTTTAGGTCTTGG - Intergenic
1096638967 12:52979112-52979134 AGTTGATGTTCCTCAGGGCTGGG + Intergenic
1096908653 12:54960658-54960680 AACTGTGATTCATTAGGTCTGGG + Intronic
1101420725 12:104548741-104548763 AGGTGTCATTCCTTAGGGCAGGG + Intronic
1101942520 12:109110598-109110620 TCTTGTTATTCCTTGGGTGTTGG + Exonic
1105249792 13:18687939-18687961 TGTTCTTATTCCTTAGTTCAAGG + Intergenic
1105602123 13:21896819-21896841 AGTTTTCATTCTGTAGGTCTGGG + Intergenic
1106102776 13:26708803-26708825 AGTTGTGATTTCTGAGGTTTTGG - Intergenic
1106272129 13:28165208-28165230 AGTTCTGATTCATTAGGTATAGG + Intronic
1106335583 13:28779634-28779656 AGTTGTGATTTCTGAGGTTTTGG + Intergenic
1106362098 13:29040035-29040057 AGTGGTGATTTCTGAGGTCTTGG + Intronic
1106391770 13:29340715-29340737 AGTGGTGATTTCTGAGGTCTTGG + Intronic
1106991900 13:35429552-35429574 ATATGTTGTTCCTTAGGTCCTGG + Intronic
1107130670 13:36891359-36891381 AGTTCTTATTCCTTAGGCAATGG - Intronic
1109917796 13:69014832-69014854 AACTGTTATTCCTTACTTCTTGG + Intergenic
1110357853 13:74589165-74589187 GTTTGTGATTCCATAGGTCTGGG + Intergenic
1110769523 13:79324131-79324153 AGTGGTTATCTCTTAGGGCTAGG - Intronic
1112988396 13:105480695-105480717 AGTTCTTACTCCTTAGATCTTGG - Intronic
1113735416 13:112674956-112674978 TGTTGTTATTCCTGAGGACTTGG - Intronic
1115265836 14:31499321-31499343 TGGTGTTATTTCTGAGGTCTTGG - Intronic
1115940650 14:38605177-38605199 AGTTGTAAGTCCACAGGTCTTGG + Intergenic
1116754238 14:48925839-48925861 AGTGGTTATTTCCTTGGTCTTGG - Intergenic
1119639852 14:76306362-76306384 AGTTCTTAACCCCTAGGTCTGGG - Intergenic
1119905208 14:78295677-78295699 AATTCTGATTCATTAGGTCTTGG + Intronic
1121720017 14:96102792-96102814 AACTGTTATTCTTTAAGTCTAGG - Intergenic
1122044756 14:99015690-99015712 AGTTGTTATTCCAAAGCTGTAGG + Intergenic
1122836482 14:104433295-104433317 AGTTGTGATTCCTTCTGTGTGGG - Intergenic
1123986262 15:25649060-25649082 AGTTCTTAATCCTTTGGTGTGGG - Intergenic
1127170590 15:56296926-56296948 AGATGTTAATCCATAGGTCTAGG + Intronic
1127555885 15:60087044-60087066 AGTTCTTTTTCCTTTGCTCTTGG + Intergenic
1128805748 15:70529811-70529833 AGTGGCTACTCCTTAGGCCTAGG + Intergenic
1128819661 15:70640316-70640338 AGTTCTGATTCCTGAGTTCTTGG + Intergenic
1129050316 15:72776031-72776053 AGTTTCTATTCCTTACGTGTGGG + Intronic
1133354536 16:5126354-5126376 AATTCTGATTCATTAGGTCTGGG - Intergenic
1138593943 16:58019281-58019303 AATTCTGATTTCTTAGGTCTTGG - Intronic
1140677814 16:77350760-77350782 ATTTCTCATTCCTTAGGCCTGGG + Intronic
1146801825 17:35830797-35830819 GGTTCTTATTCAGTAGGTCTAGG + Intronic
1147456332 17:40540494-40540516 GGTTCAGATTCCTTAGGTCTGGG + Intergenic
1148819451 17:50352211-50352233 AGTTGTTACTCCTTACAGCTGGG + Intronic
1151070029 17:71198852-71198874 AGTTGTTATGGCTTAGTTGTTGG - Intergenic
1151498617 17:74474568-74474590 AGTTGTGATTGTTGAGGTCTTGG - Exonic
1153388306 18:4525590-4525612 ATTTGTTATTGCTTATGTTTTGG + Intergenic
1154344522 18:13531090-13531112 AGTTGCTATTCCTTAACCCTGGG + Intronic
1154439039 18:14370951-14370973 TGTTCTTATTCCTTAGCTCAAGG - Intergenic
1156144690 18:34160799-34160821 ATTTGTTATTTCTTTGTTCTGGG + Intronic
1157988298 18:52465013-52465035 AGATATTATTCTTTAGGGCTAGG + Intronic
1164180621 19:22815208-22815230 AGGTGTCATTCCTTTGGGCTGGG + Intergenic
1164736515 19:30545270-30545292 AGTTCTGATTCCCTGGGTCTGGG - Intronic
1166423991 19:42659747-42659769 AGTTGTGTTTCCTGAGGTCTAGG + Intronic
1166540441 19:43601780-43601802 AGTGGTTATATCTTATGTCTGGG - Intronic
928203659 2:29268579-29268601 AGTTGTTAGTCCCTAGGCTTGGG + Intronic
930828579 2:55718911-55718933 AGTTCTAATTCAATAGGTCTGGG - Intergenic
931227793 2:60349040-60349062 AGAATTTAGTCCTTAGGTCTTGG - Intergenic
931459240 2:62435806-62435828 ATTTCTGATTCCTTAGGTCTAGG - Intergenic
931801600 2:65764243-65764265 GGTTCTTATTCATTATGTCTCGG - Intergenic
931958354 2:67453183-67453205 AGTTGCTGTTCCTTCTGTCTGGG - Intergenic
933411133 2:81926454-81926476 AGATGTTATTCCACAGGTCAGGG + Intergenic
934475828 2:94592775-94592797 AGTTTTTCTTCCTAAGGGCTGGG - Intronic
935058549 2:99588738-99588760 AGTTCTTAGTCCTTAGCTCCAGG + Intronic
935923043 2:108035606-108035628 GGTTGTGTTTCATTAGGTCTAGG - Intergenic
936646684 2:114380007-114380029 AGTTGTCAGTCCTTTGGCCTTGG - Intergenic
938441202 2:131335064-131335086 AGTTGTTATTATAAAGGTCTAGG - Intronic
939012956 2:136868384-136868406 AGTTTTTATTTATTATGTCTAGG - Intronic
940749014 2:157602801-157602823 AGTTGTTATCTCTGAGGTATGGG + Intronic
941192928 2:162408799-162408821 AATTGTTTTTCCTTATTTCTTGG - Intronic
941669514 2:168277330-168277352 AATTCTTGTTCATTAGGTCTGGG + Intergenic
941838415 2:170052248-170052270 CATTGTTTTTCCTTAGTTCTGGG + Intronic
942376868 2:175346508-175346530 AATTCTGATTCCATAGGTCTGGG + Intergenic
943099955 2:183475577-183475599 TGTTGGTATTCCTTAAGCCTTGG + Intergenic
943347799 2:186760808-186760830 AGTTGTTATTCCTTCAACCTGGG - Intronic
944654820 2:201867002-201867024 TGTTGTTATTCCTGGGGTCCTGG + Intronic
946121840 2:217523131-217523153 GGTTGTGATTCCATGGGTCTGGG - Intronic
946397517 2:219450709-219450731 CGCTGTTATTGCTTAAGTCTTGG + Intronic
946974008 2:225127638-225127660 TGGTGTTATTTCTGAGGTCTTGG + Intergenic
1170706681 20:18749990-18750012 AGTTGTTCTTCTTTACGTCAGGG + Intronic
1173056646 20:39620813-39620835 AGATGTTGTTTATTAGGTCTTGG - Intergenic
1173701626 20:45076884-45076906 AGTTGTTAGTCTTCAGGGCTTGG + Exonic
1173742629 20:45412137-45412159 AGTTGATGTTCCTTAAGACTGGG - Intergenic
1175735266 20:61381669-61381691 AATTGATATTCCTTAGGTGGGGG - Intronic
1176017800 20:62945447-62945469 ATTTGTTTTCCCTTTGGTCTGGG + Exonic
1178208981 21:30506020-30506042 TGGTGTTATTTCTGAGGTCTGGG + Intergenic
1180744405 22:18077938-18077960 AGTTGTAGTTCCTCAGCTCTCGG - Exonic
1181819856 22:25467261-25467283 AATTGTGATTCAGTAGGTCTAGG - Intergenic
1183745016 22:39687126-39687148 AGCTGTGTTTCCTTAGGCCTGGG + Exonic
949415273 3:3807145-3807167 CGTGGTTAATCCTTAGGTATAGG - Intronic
952682333 3:36108227-36108249 ATTTGTTGTTCCATAGGTTTAGG + Intergenic
952757882 3:36888309-36888331 AGTGGTGATTGCTTAGGGCTTGG + Intronic
955014658 3:55058646-55058668 AGTTATTATTCCATGGTTCTTGG + Intronic
957058426 3:75462039-75462061 AATTCTGATTCATTAGGTCTGGG - Intergenic
957128412 3:76192627-76192649 AGTTGTTCTTCCTTCAATCTAGG + Intronic
957478362 3:80756898-80756920 AGCTTTTATTCCTTAAGTTTAGG - Intergenic
957659386 3:83127455-83127477 AGTTGTTGATTCGTAGGTCTTGG + Intergenic
959505694 3:107154167-107154189 AGTTTTTATTCAGTAGGTGTGGG - Intergenic
960410879 3:117322985-117323007 AGGTGTTCATCCTAAGGTCTGGG - Intergenic
961421384 3:126807620-126807642 AGGTCTTATTCCTCAGTTCTGGG - Intronic
961890880 3:130129501-130129523 AATTCTGATTCATTAGGTCTGGG - Intergenic
962187824 3:133278874-133278896 AATTCTAATTCATTAGGTCTGGG - Intronic
962302250 3:134252749-134252771 ACTTGTTAATCCTGTGGTCTTGG + Intergenic
962747686 3:138409616-138409638 ATTTCTGATTCATTAGGTCTGGG - Intergenic
963181957 3:142367332-142367354 AGTTCTCATTCAGTAGGTCTGGG - Intronic
965149640 3:164953299-164953321 GGTTTTTTTTCCTTAGCTCTTGG - Intergenic
965196244 3:165599154-165599176 AGTTCTAATTCAGTAGGTCTGGG - Intergenic
967750426 3:193108688-193108710 AGTTGTTATTGGTTGGGACTAGG - Intergenic
968023877 3:195421231-195421253 AGTTTTCATTCAGTAGGTCTGGG + Intronic
968128564 3:196178172-196178194 AGTTGTTATTGCTCTGATCTGGG - Intergenic
969002271 4:3991919-3991941 AATTCTGATTCATTAGGTCTGGG - Intergenic
969751740 4:9116595-9116617 AATTCTGATTCATTAGGTCTGGG + Intergenic
969811652 4:9652893-9652915 AATTCTGATTCATTAGGTCTGGG + Intergenic
970388553 4:15582866-15582888 TGTTGTTATGCCTTTGGTTTTGG - Intronic
971478424 4:27093180-27093202 AAATGTTATTCCTGAAGTCTGGG + Intergenic
973845423 4:54908044-54908066 AGTAGTTGTTGCTTAGGGCTGGG + Intergenic
974276892 4:59732672-59732694 TGTTGTTATCCATTAGGTGTTGG - Intergenic
974325890 4:60414703-60414725 TGGTGTTATTTCTGAGGTCTTGG + Intergenic
974434476 4:61839617-61839639 GGTTGATATTGCTTAGGTTTTGG + Intronic
975303127 4:72815278-72815300 AATTCTTGTTCCATAGGTCTTGG - Intergenic
975995831 4:80313049-80313071 AGTTTTTGTTCCTTAGTTTTTGG - Intronic
976458725 4:85282620-85282642 ATTTGGTATTCATTAGATCTGGG + Intergenic
976987700 4:91323344-91323366 GGTTCTAATTCCTTAGGTTTAGG + Intronic
978469384 4:109046592-109046614 AGATGGCATGCCTTAGGTCTAGG - Intronic
981131020 4:141158544-141158566 AGTTGTAATTCCTAAAGCCTTGG - Intronic
982937455 4:161500128-161500150 TGTTTTTATTCCTAAGGTCTGGG - Exonic
989787983 5:45354170-45354192 AATTCTTATTCCATAGGTCTTGG - Intronic
990241195 5:53818301-53818323 AGTTCTAATTCAATAGGTCTAGG + Intergenic
990984914 5:61632390-61632412 AGTTCTGATTCCGTAGGTCTGGG + Intergenic
992086588 5:73283365-73283387 GGTTGTTATAGCTTAGGTCAGGG - Intergenic
993060327 5:83030551-83030573 TGTTTTTATTCTCTAGGTCTTGG + Intergenic
993625797 5:90223362-90223384 TTTTGTTATTCTGTAGGTCTGGG - Intergenic
993959511 5:94279839-94279861 AGGTGCTTTTCCTTAGGCCTAGG - Intronic
994016223 5:94969067-94969089 AATTGATATTTCCTAGGTCTAGG - Intronic
994499875 5:100561338-100561360 GTTTGTTATTCACTAGGTCTGGG + Intronic
995437272 5:112151003-112151025 AATTGCTATTCATTATGTCTGGG + Intronic
996872269 5:128204398-128204420 ATTTGTGATTGCTTAGGGCTGGG - Intergenic
997217428 5:132124875-132124897 TGTTGTTTTTGCTTAGGTCTTGG + Intergenic
998170081 5:139867548-139867570 AGCTCTTCTTCCTTAGCTCTTGG + Intronic
998234374 5:140385618-140385640 AGTGGTAATTCCTTTGGTCTTGG - Intergenic
999995783 5:157091002-157091024 TGTTGAGATTCCTTAGGGCTGGG - Intronic
1002451422 5:179321111-179321133 AGGTGTTATTCCTCAAGTGTTGG - Intronic
1003287385 6:4746478-4746500 TGTTGTTGTGCCCTAGGTCTGGG - Intronic
1004344972 6:14840731-14840753 AGTTGTGATTCAGTAAGTCTGGG + Intergenic
1007152237 6:39705223-39705245 AGTTCTGATTCAATAGGTCTGGG + Intronic
1012137270 6:95573899-95573921 AGGTGTAACTGCTTAGGTCTGGG + Intergenic
1012357392 6:98332412-98332434 AATTGTTATTACTCAGTTCTTGG + Intergenic
1013451733 6:110288330-110288352 AGTAGTGATTCCGGAGGTCTGGG - Intronic
1014347503 6:120292735-120292757 ATTTATTATACCTTAAGTCTTGG + Intergenic
1014793194 6:125698492-125698514 ATTTGTGATTGCTTAGGTCTAGG + Intergenic
1015833169 6:137390950-137390972 AGTTGGTTTTCATAAGGTCTAGG + Intergenic
1016323546 6:142874564-142874586 AGTTGTTAGTCCTTAGGCATAGG - Intronic
1016559591 6:145380304-145380326 TCTTGTTATTTCTTAGGTTTTGG - Intergenic
1018244490 6:161809286-161809308 AGTGGTAATTCCTCAGGACTCGG - Intronic
1018619939 6:165720493-165720515 ATTTTTTATTCTTTAGGTTTGGG - Intronic
1020994454 7:15245294-15245316 TGTTGTTTTCCCTGAGGTCTGGG + Intronic
1024574477 7:50752944-50752966 AGTTTCTATTCGTTAGCTCTTGG - Intronic
1026182990 7:68058558-68058580 AATTTTTATTCCTTAGGTTCAGG + Intergenic
1026336306 7:69396927-69396949 AGTTCTGATTCAGTAGGTCTGGG + Intergenic
1026531197 7:71198947-71198969 ATTTCTGATTCCTTAGGTCTTGG + Intronic
1027527396 7:79287178-79287200 AATTATTATTCAGTAGGTCTGGG - Intronic
1027732718 7:81896634-81896656 AGTGGTGATTTCTGAGGTCTTGG + Intergenic
1027989567 7:85340204-85340226 AGTTGATACTACTTAGCTCTTGG + Intergenic
1030416846 7:109255438-109255460 AGTTGTTATTTTTTATGTTTGGG + Intergenic
1031630403 7:124036938-124036960 CATTGAGATTCCTTAGGTCTGGG + Intergenic
1032581028 7:133103666-133103688 GGTTGTGTTTCATTAGGTCTGGG + Intergenic
1036374946 8:8192025-8192047 AATTCTGATTCATTAGGTCTGGG + Intergenic
1036854597 8:12231126-12231148 AATTCTGATTCATTAGGTCTGGG - Intergenic
1036875956 8:12473619-12473641 AATTCTGATTCATTAGGTCTGGG - Intergenic
1040927429 8:52699167-52699189 AGTTGTTTTTCCTTCTGTTTAGG - Intronic
1041407085 8:57511564-57511586 AGGTGTGTTTGCTTAGGTCTTGG + Intergenic
1041818588 8:62003110-62003132 AGGTGTTCTTCCTTCAGTCTTGG - Intergenic
1041860738 8:62510019-62510041 AGGAGTAATTCCTTAGGACTGGG + Intronic
1042842143 8:73134614-73134636 AGATGTAATTACTCAGGTCTAGG + Intergenic
1048095176 8:131284296-131284318 TGTTATTATTGCTTAGGTATAGG - Intergenic
1048302292 8:133260481-133260503 AATTTTTATTCCGTTGGTCTGGG - Intronic
1050745887 9:8875517-8875539 AGTTGTAATTTCTTAGGTATCGG - Intronic
1052112426 9:24603574-24603596 AATGGTTATTACTTAGGTATAGG - Intergenic
1055019701 9:71656572-71656594 ATTTCTGATTCATTAGGTCTGGG - Intergenic
1055220076 9:73918676-73918698 AGTTCTTATTTCATAGGTCAAGG - Intergenic
1056034085 9:82585203-82585225 ACTTGTACTTCCTTTGGTCTTGG - Intergenic
1056526307 9:87446106-87446128 GGTTGTTTTTCCTTTGGTATAGG - Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058006618 9:99922870-99922892 AGTTGTTCTTCCCAAGGTCTGGG + Intronic
1059229792 9:112709071-112709093 AGAAGTAAGTCCTTAGGTCTAGG - Intronic
1061652766 9:132064358-132064380 ATTTGTTATTCCTTTTATCTCGG - Intronic
1186296723 X:8156503-8156525 AGTTTCTATTCAATAGGTCTTGG - Intergenic
1188239766 X:27771518-27771540 AGTTCTTATGCCCTAGGTCTGGG - Intergenic
1188382805 X:29518316-29518338 GATTGTGATTCCATAGGTCTTGG + Intronic
1196820638 X:119697696-119697718 AGTTCTGATTCAGTAGGTCTCGG - Intergenic
1196907644 X:120453360-120453382 AGTTATTAATCCCCAGGTCTAGG + Intronic
1197151924 X:123229559-123229581 AGTTTCTTTTCCCTAGGTCTTGG - Intronic
1197598480 X:128496292-128496314 AATTCTAATTCATTAGGTCTGGG + Intergenic
1198086863 X:133290258-133290280 GGTTGTGATTCAGTAGGTCTGGG - Intergenic
1198318876 X:135498673-135498695 AGTTTTGATTCTTTAGATCTGGG + Intergenic
1198321763 X:135524508-135524530 ACTGCTTATTTCTTAGGTCTTGG + Intronic
1198534782 X:137574842-137574864 CCTTGTTATTCCTCAGTTCTGGG + Intronic