ID: 1086667646

View in Genome Browser
Species Human (GRCh38)
Location 11:89503265-89503287
Sequence TGTATGGGAGAGTCTAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086667646_1086667649 17 Left 1086667646 11:89503265-89503287 CCTCAACTAGACTCTCCCATACA No data
Right 1086667649 11:89503305-89503327 AAAGAGTCCAATTCTATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086667646 Original CRISPR TGTATGGGAGAGTCTAGTTG AGG (reversed) Intergenic
No off target data available for this crispr