ID: 1086667649

View in Genome Browser
Species Human (GRCh38)
Location 11:89503305-89503327
Sequence AAAGAGTCCAATTCTATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086667646_1086667649 17 Left 1086667646 11:89503265-89503287 CCTCAACTAGACTCTCCCATACA No data
Right 1086667649 11:89503305-89503327 AAAGAGTCCAATTCTATTTATGG No data
1086667648_1086667649 1 Left 1086667648 11:89503281-89503303 CCATACAGACTAATTTAAACAAC No data
Right 1086667649 11:89503305-89503327 AAAGAGTCCAATTCTATTTATGG No data
1086667647_1086667649 2 Left 1086667647 11:89503280-89503302 CCCATACAGACTAATTTAAACAA No data
Right 1086667649 11:89503305-89503327 AAAGAGTCCAATTCTATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086667649 Original CRISPR AAAGAGTCCAATTCTATTTA TGG Intergenic
No off target data available for this crispr