ID: 1086678590

View in Genome Browser
Species Human (GRCh38)
Location 11:89640562-89640584
Sequence AGAGGGACTTCAAGTATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086678590_1086678594 -2 Left 1086678590 11:89640562-89640584 CCAAAAATACTTGAAGTCCCTCT No data
Right 1086678594 11:89640583-89640605 CTAATGATTGCAGGATTCCCTGG No data
1086678590_1086678595 8 Left 1086678590 11:89640562-89640584 CCAAAAATACTTGAAGTCCCTCT No data
Right 1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086678590 Original CRISPR AGAGGGACTTCAAGTATTTT TGG (reversed) Intergenic
No off target data available for this crispr