ID: 1086678593

View in Genome Browser
Species Human (GRCh38)
Location 11:89640580-89640602
Sequence GGGAATCCTGCAATCATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086678593_1086678595 -10 Left 1086678593 11:89640580-89640602 CCTCTAATGATTGCAGGATTCCC No data
Right 1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086678593 Original CRISPR GGGAATCCTGCAATCATTAG AGG (reversed) Intergenic
No off target data available for this crispr