ID: 1086678595

View in Genome Browser
Species Human (GRCh38)
Location 11:89640593-89640615
Sequence CAGGATTCCCTGGTGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086678590_1086678595 8 Left 1086678590 11:89640562-89640584 CCAAAAATACTTGAAGTCCCTCT No data
Right 1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG No data
1086678592_1086678595 -9 Left 1086678592 11:89640579-89640601 CCCTCTAATGATTGCAGGATTCC No data
Right 1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG No data
1086678593_1086678595 -10 Left 1086678593 11:89640580-89640602 CCTCTAATGATTGCAGGATTCCC No data
Right 1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086678595 Original CRISPR CAGGATTCCCTGGTGAATAA AGG Intergenic
No off target data available for this crispr