ID: 1086678751

View in Genome Browser
Species Human (GRCh38)
Location 11:89641906-89641928
Sequence TTGAAATATACCCATGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086678745_1086678751 29 Left 1086678745 11:89641854-89641876 CCTAAACTCTCCAGATTTTCAAT No data
Right 1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG No data
1086678748_1086678751 -5 Left 1086678748 11:89641888-89641910 CCATCAGAGAGCTTTCAATTGAA No data
Right 1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG No data
1086678747_1086678751 3 Left 1086678747 11:89641880-89641902 CCATTTGTCCATCAGAGAGCTTT No data
Right 1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG No data
1086678746_1086678751 19 Left 1086678746 11:89641864-89641886 CCAGATTTTCAATTTGCCATTTG No data
Right 1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086678751 Original CRISPR TTGAAATATACCCATGGGTC AGG Intergenic
No off target data available for this crispr