ID: 1086690094

View in Genome Browser
Species Human (GRCh38)
Location 11:89780144-89780166
Sequence GTATGGTGATGGAGGAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690094_1086690098 -10 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690098 11:89780157-89780179 ATCACCATACACCCAGTTCTAGG No data
1086690094_1086690102 2 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690102 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG No data
1086690094_1086690103 9 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690094_1086690106 19 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690106 11:89780186-89780208 CTCAGGAAAATGGTTACCTCGGG No data
1086690094_1086690105 18 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690094 Original CRISPR GTATGGTGATGGAGGAGGCC CGG (reversed) Intergenic
No off target data available for this crispr