ID: 1086690095

View in Genome Browser
Species Human (GRCh38)
Location 11:89780149-89780171
Sequence TGGGTGTATGGTGATGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690095_1086690108 30 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690095_1086690103 4 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690095_1086690106 14 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690106 11:89780186-89780208 CTCAGGAAAATGGTTACCTCGGG No data
1086690095_1086690105 13 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690095_1086690102 -3 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690102 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690095 Original CRISPR TGGGTGTATGGTGATGGAGG AGG (reversed) Intergenic
No off target data available for this crispr