ID: 1086690097

View in Genome Browser
Species Human (GRCh38)
Location 11:89780155-89780177
Sequence TAGAACTGGGTGTATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690097_1086690102 -9 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690102 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG No data
1086690097_1086690103 -2 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690097_1086690106 8 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690106 11:89780186-89780208 CTCAGGAAAATGGTTACCTCGGG No data
1086690097_1086690108 24 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690097_1086690105 7 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690097 Original CRISPR TAGAACTGGGTGTATGGTGA TGG (reversed) Intergenic