ID: 1086690100

View in Genome Browser
Species Human (GRCh38)
Location 11:89780168-89780190
Sequence CTGAGGTCTTTCCTAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690100_1086690108 11 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690100_1086690111 19 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690111 11:89780210-89780232 CCCTCAGCAGCAAGGTTCTCAGG No data
1086690100_1086690105 -6 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690100_1086690106 -5 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690106 11:89780186-89780208 CTCAGGAAAATGGTTACCTCGGG No data
1086690100_1086690113 23 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690113 11:89780214-89780236 CAGCAGCAAGGTTCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690100 Original CRISPR CTGAGGTCTTTCCTAGAACT GGG (reversed) Intergenic
No off target data available for this crispr