ID: 1086690103

View in Genome Browser
Species Human (GRCh38)
Location 11:89780176-89780198
Sequence TAGGAAAGACCTCAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690095_1086690103 4 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690093_1086690103 10 Left 1086690093 11:89780143-89780165 CCCGGGCCTCCTCCATCACCATA No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690097_1086690103 -2 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690099_1086690103 -8 Left 1086690099 11:89780161-89780183 CCATACACCCAGTTCTAGGAAAG No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690094_1086690103 9 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690091_1086690103 27 Left 1086690091 11:89780126-89780148 CCTAAAAGCATCAATGACCCGGG No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data
1086690096_1086690103 1 Left 1086690096 11:89780152-89780174 CCTCCATCACCATACACCCAGTT No data
Right 1086690103 11:89780176-89780198 TAGGAAAGACCTCAGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690103 Original CRISPR TAGGAAAGACCTCAGGAAAA TGG Intergenic
No off target data available for this crispr