ID: 1086690105

View in Genome Browser
Species Human (GRCh38)
Location 11:89780185-89780207
Sequence CCTCAGGAAAATGGTTACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690101_1086690105 -7 Left 1086690101 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690100_1086690105 -6 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690097_1086690105 7 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690094_1086690105 18 Left 1086690094 11:89780144-89780166 CCGGGCCTCCTCCATCACCATAC No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690099_1086690105 1 Left 1086690099 11:89780161-89780183 CCATACACCCAGTTCTAGGAAAG No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690093_1086690105 19 Left 1086690093 11:89780143-89780165 CCCGGGCCTCCTCCATCACCATA No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690096_1086690105 10 Left 1086690096 11:89780152-89780174 CCTCCATCACCATACACCCAGTT No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
1086690095_1086690105 13 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690105 Original CRISPR CCTCAGGAAAATGGTTACCT CGG Intergenic
No off target data available for this crispr