ID: 1086690108

View in Genome Browser
Species Human (GRCh38)
Location 11:89780202-89780224
Sequence CCTCGGGCCCCTCAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690095_1086690108 30 Left 1086690095 11:89780149-89780171 CCTCCTCCATCACCATACACCCA No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690099_1086690108 18 Left 1086690099 11:89780161-89780183 CCATACACCCAGTTCTAGGAAAG No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690100_1086690108 11 Left 1086690100 11:89780168-89780190 CCCAGTTCTAGGAAAGACCTCAG No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690096_1086690108 27 Left 1086690096 11:89780152-89780174 CCTCCATCACCATACACCCAGTT No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690101_1086690108 10 Left 1086690101 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690104_1086690108 -6 Left 1086690104 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data
1086690097_1086690108 24 Left 1086690097 11:89780155-89780177 CCATCACCATACACCCAGTTCTA No data
Right 1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690108 Original CRISPR CCTCGGGCCCCTCAGCAGCA AGG Intergenic
No off target data available for this crispr