ID: 1086690718

View in Genome Browser
Species Human (GRCh38)
Location 11:89786836-89786858
Sequence GAGGCTGTTCAGGCCCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086690715_1086690718 -4 Left 1086690715 11:89786817-89786839 CCTGCGCTGTTTTACTAAAGAGG No data
Right 1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086690718 Original CRISPR GAGGCTGTTCAGGCCCAGTC AGG Intergenic