ID: 1086695071

View in Genome Browser
Species Human (GRCh38)
Location 11:89834505-89834527
Sequence CCTTGGAAAGATGGATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086695071_1086695080 2 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695080 11:89834530-89834552 TTCTGGGCTGGAATTTTTAAGGG No data
1086695071_1086695086 21 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695086 11:89834549-89834571 AGGGGATTGTGGAAGGTGAGGGG No data
1086695071_1086695083 14 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG No data
1086695071_1086695079 1 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695079 11:89834529-89834551 GTTCTGGGCTGGAATTTTTAAGG No data
1086695071_1086695087 25 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695087 11:89834553-89834575 GATTGTGGAAGGTGAGGGGCTGG No data
1086695071_1086695085 20 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695085 11:89834548-89834570 AAGGGGATTGTGGAAGGTGAGGG No data
1086695071_1086695081 3 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695081 11:89834531-89834553 TCTGGGCTGGAATTTTTAAGGGG No data
1086695071_1086695077 -10 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695077 11:89834518-89834540 CTTTCCAAGGAGTTCTGGGCTGG No data
1086695071_1086695084 19 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data
1086695071_1086695082 10 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695082 11:89834538-89834560 TGGAATTTTTAAGGGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086695071 Original CRISPR CCTTGGAAAGATGGATTTGA GGG (reversed) Intergenic
No off target data available for this crispr