ID: 1086695078

View in Genome Browser
Species Human (GRCh38)
Location 11:89834522-89834544
Sequence AATTCCAGCCCAGAACTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086695078_1086695086 4 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695086 11:89834549-89834571 AGGGGATTGTGGAAGGTGAGGGG No data
1086695078_1086695088 26 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695088 11:89834571-89834593 GCTGGAAAATTCTGCTTGATTGG No data
1086695078_1086695082 -7 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695082 11:89834538-89834560 TGGAATTTTTAAGGGGATTGTGG No data
1086695078_1086695085 3 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695085 11:89834548-89834570 AAGGGGATTGTGGAAGGTGAGGG No data
1086695078_1086695084 2 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data
1086695078_1086695083 -3 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG No data
1086695078_1086695087 8 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695087 11:89834553-89834575 GATTGTGGAAGGTGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086695078 Original CRISPR AATTCCAGCCCAGAACTCCT TGG (reversed) Intergenic
No off target data available for this crispr