ID: 1086695081

View in Genome Browser
Species Human (GRCh38)
Location 11:89834531-89834553
Sequence TCTGGGCTGGAATTTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086695073_1086695081 2 Left 1086695073 11:89834506-89834528 CCTCAAATCCATCTTTCCAAGGA No data
Right 1086695081 11:89834531-89834553 TCTGGGCTGGAATTTTTAAGGGG No data
1086695075_1086695081 -6 Left 1086695075 11:89834514-89834536 CCATCTTTCCAAGGAGTTCTGGG No data
Right 1086695081 11:89834531-89834553 TCTGGGCTGGAATTTTTAAGGGG No data
1086695071_1086695081 3 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695081 11:89834531-89834553 TCTGGGCTGGAATTTTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086695081 Original CRISPR TCTGGGCTGGAATTTTTAAG GGG Intergenic
No off target data available for this crispr