ID: 1086695084

View in Genome Browser
Species Human (GRCh38)
Location 11:89834547-89834569
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086695075_1086695084 10 Left 1086695075 11:89834514-89834536 CCATCTTTCCAAGGAGTTCTGGG No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data
1086695071_1086695084 19 Left 1086695071 11:89834505-89834527 CCCTCAAATCCATCTTTCCAAGG No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data
1086695073_1086695084 18 Left 1086695073 11:89834506-89834528 CCTCAAATCCATCTTTCCAAGGA No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data
1086695078_1086695084 2 Left 1086695078 11:89834522-89834544 CCAAGGAGTTCTGGGCTGGAATT No data
Right 1086695084 11:89834547-89834569 TAAGGGGATTGTGGAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086695084 Original CRISPR TAAGGGGATTGTGGAAGGTG AGG Intergenic
No off target data available for this crispr