ID: 1086698525

View in Genome Browser
Species Human (GRCh38)
Location 11:89872503-89872525
Sequence ATAACGTATCTGGGGAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086698525 Original CRISPR ATAACGTATCTGGGGAAATT GGG (reversed) Intronic
905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG + Intergenic
911231742 1:95369054-95369076 ATAAAGTATATGTGGAAATGGGG - Intergenic
912037408 1:105335725-105335747 ATAAAGTAGCTGGGGGAATTGGG + Intergenic
916665766 1:166965849-166965871 AAAAAGTATCTTAGGAAATTGGG - Intronic
916787547 1:168097351-168097373 ATAACTTGTCTGGGGAGACTTGG - Intronic
917027962 1:170662810-170662832 ATAACAGCTGTGGGGAAATTTGG - Intronic
918718898 1:187826765-187826787 ATAAGGTGTATGGGGAGATTGGG - Intergenic
918851971 1:189703469-189703491 ATATTTTATGTGGGGAAATTAGG + Intergenic
921050635 1:211508911-211508933 ATAACTTTCCTGGGCAAATTGGG + Intergenic
921556941 1:216610353-216610375 ATTAAGGATATGGGGAAATTAGG - Intronic
1065742202 10:28807233-28807255 AAAACCTCTCTGGGGAAAATAGG - Intergenic
1067771442 10:49129572-49129594 TTAACTGATATGGGGAAATTTGG - Intergenic
1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG + Intronic
1071744536 10:88401326-88401348 ATAACATATATGTTGAAATTCGG + Intronic
1074595583 10:114862589-114862611 TTAAAGGATTTGGGGAAATTGGG + Exonic
1081823733 11:46025683-46025705 ATAACATTTTTGGGGAATTTGGG - Intronic
1082175612 11:49055600-49055622 ATAACATATCTGGAGAAATTGGG - Intronic
1086690137 11:89780469-89780491 ATAACATATCTGGGGAAACTGGG + Intergenic
1086698525 11:89872503-89872525 ATAACGTATCTGGGGAAATTGGG - Intronic
1086715717 11:90059488-90059510 ATAACATATCTGGGGAAACTGGG - Intergenic
1087151531 11:94864568-94864590 ATAACTGAGCTGGGGAAATTGGG + Intronic
1090848483 11:130549859-130549881 ATAATCTCTCTGGGGTAATTTGG + Intergenic
1091042031 11:132290344-132290366 ATCACTGATATGGGGAAATTGGG + Intronic
1092796502 12:12115146-12115168 AAAACCTATCTGGGGAAAAAAGG + Intronic
1095192820 12:39277779-39277801 GTGATGTATCTGGGGAAATGAGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097994987 12:65878598-65878620 ATAAAGAAACTGGGGAAACTGGG - Intronic
1099074706 12:78092183-78092205 AACAGGTATCTGTGGAAATTGGG + Intronic
1099301421 12:80899572-80899594 TTTATGTATCTGGGAAAATTTGG + Intronic
1100637813 12:96452251-96452273 ATAATGGTGCTGGGGAAATTGGG + Intergenic
1101637577 12:106558293-106558315 ATAATTCACCTGGGGAAATTAGG - Intronic
1109920342 13:69049777-69049799 AAAACATATTTGAGGAAATTAGG + Intergenic
1110091924 13:71461735-71461757 ATAACTTCTCTGGAGAAATTTGG + Intronic
1111095413 13:83507599-83507621 ATGACATATCTGGGTAGATTGGG + Intergenic
1114510957 14:23260414-23260436 CTAACATATGTGGGGAAATACGG - Intronic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG + Intergenic
1117402541 14:55371161-55371183 ATAACGACTTTGGGGAAAATAGG + Intronic
1117536058 14:56704368-56704390 ACAAAGCAGCTGGGGAAATTGGG + Intronic
1118499443 14:66345044-66345066 ATAAAGTATCTGAGAATATTTGG - Intergenic
1119977681 14:79043521-79043543 GTAAAGAATTTGGGGAAATTGGG - Intronic
1120825581 14:88951884-88951906 ACAAGTTATATGGGGAAATTGGG + Intergenic
1122333691 14:100950217-100950239 ATAACGTATGTGAGGTCATTTGG + Intergenic
1127689845 15:61384637-61384659 ATAAAGTGTCTGGGGAAAAAAGG + Intergenic
1134760250 16:16708299-16708321 ATAATGTATGTGGGGAAAACAGG - Intergenic
1134985822 16:18650906-18650928 ATAATGTATGTGGGGAAAACAGG + Intergenic
1139078123 16:63480214-63480236 TTAAAGTCTCAGGGGAAATTAGG - Intergenic
1141902166 16:86998075-86998097 ATAATTTCTCTGGGGAAACTGGG - Intergenic
1152158305 17:78649540-78649562 ATGACTTAACTTGGGAAATTAGG + Intergenic
1155736241 18:29225986-29226008 TTATCGTATCTGAGGAAAATAGG - Intergenic
1156127775 18:33927914-33927936 ATATAATAGCTGGGGAAATTGGG - Intronic
1158756648 18:60332989-60333011 AAAACATATTTGGGGAAATAAGG + Intergenic
1165446577 19:35860127-35860149 TTGAGGTAACTGGGGAAATTGGG + Intronic
1168179960 19:54655196-54655218 ACAAAGTCTCTGGGGCAATTGGG - Intronic
925946472 2:8868706-8868728 ATAACATATCTAGGACAATTTGG + Intronic
926323880 2:11767671-11767693 ATAGCGTATCTGTGGAGACTTGG + Intronic
926948140 2:18211555-18211577 ATAACGTATCTAGGGATTTTTGG + Intronic
926950528 2:18237851-18237873 ATCAAGTATCTGGGGAACTTAGG + Intronic
928547621 2:32343074-32343096 AAACCGTATCTGGAAAAATTTGG + Intergenic
930373843 2:50539587-50539609 ATAAAGTATCAGTGGAATTTTGG - Intronic
931377168 2:61718044-61718066 ATAACTTTACTGGGGACATTTGG - Intergenic
934073358 2:88406395-88406417 ATAACGTATTTGTATAAATTAGG + Intergenic
939762689 2:146202214-146202236 ACCACGTATCTGGGTAATTTTGG + Intergenic
940444245 2:153758205-153758227 ATAAAGGATATGGGGAAATTTGG - Intergenic
941617338 2:167735720-167735742 ATAATGTATCTAGGGCACTTGGG - Intergenic
943896879 2:193374834-193374856 ATAAAGTATCTCAGGAAAATAGG - Intergenic
944265886 2:197726000-197726022 ATAAAGCATCTTGGGAAATTAGG - Intronic
944353115 2:198753758-198753780 ATATCGTATTGGGGGAAATGGGG + Intergenic
1169894613 20:10489577-10489599 AAAAGGGTTCTGGGGAAATTAGG - Intronic
1170293678 20:14800517-14800539 ATAACGTATCTGATGAGAGTAGG + Intronic
1177193459 21:17877601-17877623 ATAATGATTCTGGGTAAATTGGG + Intergenic
1177957487 21:27617297-27617319 ACAACGTATCTGCTGAAATCTGG + Intergenic
1181030869 22:20148394-20148416 AGCACGTCTCTGTGGAAATTGGG - Intergenic
1181512455 22:23394993-23395015 AGCACGTCTCTGTGGAAATTGGG + Intergenic
949784081 3:7721331-7721353 ATAACGTTTCTGGGGGAATGTGG + Intronic
949823528 3:8140403-8140425 ATAATGTATATAGGGAATTTTGG + Intergenic
950210939 3:11122613-11122635 ATAACGTTTTTAAGGAAATTGGG - Intergenic
953123509 3:40069378-40069400 AAAAAGTATCTTGCGAAATTTGG - Intronic
956484997 3:69712666-69712688 GTAATGAATCTGGGGAAAATGGG - Intergenic
956861886 3:73332760-73332782 ACAACGTATCTGGCTAAATGTGG + Intergenic
960398285 3:117164443-117164465 ATCTAGTATTTGGGGAAATTTGG - Intergenic
961954379 3:130786521-130786543 ATGACTTACATGGGGAAATTGGG - Intergenic
962457636 3:135579610-135579632 AGAACGTAGAAGGGGAAATTAGG + Intergenic
964401270 3:156301786-156301808 AAAAAATATCTGGTGAAATTTGG - Intronic
972058588 4:34837142-34837164 ATAAAGTATCTGGGAAGATATGG + Intergenic
974383407 4:61172618-61172640 ATAAAGTATGTTTGGAAATTAGG + Intergenic
975541607 4:75518096-75518118 ATACAGTATCTTGGGAAAGTTGG + Intronic
975844315 4:78508836-78508858 ACAGCGTATCTGGGGAAATGAGG - Intronic
984490958 4:180433703-180433725 ATAATGTCTCTGGGGAAGATTGG + Intergenic
987581450 5:19798829-19798851 ATAACATATCTTTGGAAATTAGG + Intronic
989237710 5:39168519-39168541 ATAACCTAACTGTGGCAATTAGG - Intronic
991070746 5:62477547-62477569 ATAATGTATCTTGGAAGATTAGG - Intronic
991422858 5:66459061-66459083 ATAAAGTATCTGAAGCAATTGGG + Intergenic
992678971 5:79134169-79134191 AAAACGTTTCTGGGGAAAATGGG - Intronic
993191792 5:84692548-84692570 GTAAAGTATCTGGGGAGGTTAGG - Intergenic
998694451 5:144623567-144623589 ATTAAGAATTTGGGGAAATTAGG + Intergenic
1004928470 6:20438724-20438746 ATAACCAATCTGGGCAATTTGGG + Intronic
1008653511 6:53587634-53587656 ATAAAGTAAATGGAGAAATTGGG - Intronic
1012426079 6:99116184-99116206 ATTACGTATCTGTGGAACTCAGG - Intergenic
1015213770 6:130726571-130726593 ATGGCTTTTCTGGGGAAATTGGG - Intergenic
1019615896 7:1961326-1961348 TTAACGTAGTTGGTGAAATTAGG - Intronic
1024184729 7:46938601-46938623 ATAAATAATCTGGGGAAATCTGG + Intergenic
1026216258 7:68352005-68352027 ATAAGTTATCTGGGGGAGTTTGG - Intergenic
1026686934 7:72519050-72519072 GCAACAAATCTGGGGAAATTGGG - Intergenic
1027950308 7:84807158-84807180 ATAAGGAATCTGGGAAAATCAGG - Intergenic
1031189128 7:118524159-118524181 ATAATGTAACTGGAGATATTTGG + Intergenic
1031969025 7:128050378-128050400 ATAAGTTATCTGGGGAAAAGAGG - Intronic
1032180366 7:129671398-129671420 ATAACGTATGTGCTGAGATTAGG - Intronic
1032185753 7:129724247-129724269 ATATCTTCTCTGGAGAAATTTGG - Intronic
1032586168 7:133148896-133148918 ATCATGTATGTGGGGAAATTTGG - Intergenic
1040566660 8:48573546-48573568 ATCACGAATCCGGGGAAAGTAGG + Intergenic
1041313728 8:56540870-56540892 ATAACATTTCCGGGGAAAATGGG + Intergenic
1042354516 8:67811749-67811771 ATAACATTTTTGGGGAATTTTGG + Intergenic
1042804460 8:72756533-72756555 ATAACATATTTTGGGAAATTGGG + Intronic
1043104470 8:76090288-76090310 ATAAGGCATCTGGTGGAATTTGG - Intergenic
1046504564 8:115120706-115120728 AAAAGGTATATGGGAAAATTTGG + Intergenic
1046755314 8:117967074-117967096 TTAACACATCTTGGGAAATTCGG + Intronic
1053677356 9:40447496-40447518 TCAACGTATCTAGGGTAATTTGG + Intergenic
1054286362 9:63177416-63177438 TCAACGTATCTAGGGTAATTTGG - Intergenic
1054290429 9:63283023-63283045 TCAACGTATCTAGGGTAATTTGG + Intergenic
1054388452 9:64587564-64587586 TCAACGTATCTAGGGTAATTTGG + Intergenic
1054507266 9:65928799-65928821 TCAACGTATCTAGGGTAATTTGG - Intergenic
1056456897 9:86768893-86768915 ATAACGTATTTTGTGAAACTTGG - Intergenic
1058428388 9:104896428-104896450 ATAAATTAGCTTGGGAAATTTGG - Intronic
1059866127 9:118515710-118515732 ATGACATATCTGGGGAAAAGGGG + Intergenic
1190751644 X:53366973-53366995 AGAAGGTATCTGGGGAAAAAGGG + Intergenic
1194029325 X:88791743-88791765 ATAAGGTATGTGAGAAAATTAGG - Intergenic
1195981171 X:110580068-110580090 ATAATGTACCTGGGGGAAGTGGG - Intergenic
1196107100 X:111908397-111908419 ATAATTTATCTTGGAAAATTTGG + Intronic
1197082386 X:122434989-122435011 AAAACAGATCTGGGAAAATTGGG - Intergenic
1198385908 X:136129229-136129251 ATAACATCTATGGGGAAGTTGGG + Intergenic
1198407344 X:136326597-136326619 ATAATTCACCTGGGGAAATTAGG + Intronic