ID: 1086701234

View in Genome Browser
Species Human (GRCh38)
Location 11:89902093-89902115
Sequence CTGCAGTTCTGGAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701223_1086701234 29 Left 1086701223 11:89902041-89902063 CCTAGTTCCACAATCTCCTGGAA No data
Right 1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG No data
1086701225_1086701234 22 Left 1086701225 11:89902048-89902070 CCACAATCTCCTGGAAAGCAGGA No data
Right 1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG No data
1086701226_1086701234 13 Left 1086701226 11:89902057-89902079 CCTGGAAAGCAGGAAGCCTCACA No data
Right 1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG No data
1086701227_1086701234 -3 Left 1086701227 11:89902073-89902095 CCTCACAATTCCCAAGCATGCTG No data
Right 1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701234 Original CRISPR CTGCAGTTCTGGAGGGCACA GGG Intergenic
No off target data available for this crispr