ID: 1086701807

View in Genome Browser
Species Human (GRCh38)
Location 11:89907066-89907088
Sequence TTCTTATATGCAAGGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701807_1086701814 -6 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701814 11:89907083-89907105 TAAGAAACAGTGTGACAGGCGGG No data
1086701807_1086701815 -5 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701815 11:89907084-89907106 AAGAAACAGTGTGACAGGCGGGG No data
1086701807_1086701818 17 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG No data
1086701807_1086701813 -7 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701813 11:89907082-89907104 ATAAGAAACAGTGTGACAGGCGG No data
1086701807_1086701819 18 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data
1086701807_1086701816 -2 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701816 11:89907087-89907109 AAACAGTGTGACAGGCGGGGTGG No data
1086701807_1086701812 -10 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701812 11:89907079-89907101 CATATAAGAAACAGTGTGACAGG No data
1086701807_1086701817 16 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701817 11:89907105-89907127 GGTGGACACACCCTGCGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701807 Original CRISPR TTCTTATATGCAAGGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr