ID: 1086701811

View in Genome Browser
Species Human (GRCh38)
Location 11:89907074-89907096
Sequence CACACTGTTTCTTATATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701811_1086701817 8 Left 1086701811 11:89907074-89907096 CCTTGCATATAAGAAACAGTGTG No data
Right 1086701817 11:89907105-89907127 GGTGGACACACCCTGCGATATGG No data
1086701811_1086701818 9 Left 1086701811 11:89907074-89907096 CCTTGCATATAAGAAACAGTGTG No data
Right 1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG No data
1086701811_1086701816 -10 Left 1086701811 11:89907074-89907096 CCTTGCATATAAGAAACAGTGTG No data
Right 1086701816 11:89907087-89907109 AAACAGTGTGACAGGCGGGGTGG No data
1086701811_1086701819 10 Left 1086701811 11:89907074-89907096 CCTTGCATATAAGAAACAGTGTG No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701811 Original CRISPR CACACTGTTTCTTATATGCA AGG (reversed) Intergenic
No off target data available for this crispr