ID: 1086701812

View in Genome Browser
Species Human (GRCh38)
Location 11:89907079-89907101
Sequence CATATAAGAAACAGTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701807_1086701812 -10 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701812 11:89907079-89907101 CATATAAGAAACAGTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701812 Original CRISPR CATATAAGAAACAGTGTGAC AGG Intergenic