ID: 1086701813

View in Genome Browser
Species Human (GRCh38)
Location 11:89907082-89907104
Sequence ATAAGAAACAGTGTGACAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701807_1086701813 -7 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701813 11:89907082-89907104 ATAAGAAACAGTGTGACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701813 Original CRISPR ATAAGAAACAGTGTGACAGG CGG Intergenic