ID: 1086701815

View in Genome Browser
Species Human (GRCh38)
Location 11:89907084-89907106
Sequence AAGAAACAGTGTGACAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701807_1086701815 -5 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701815 11:89907084-89907106 AAGAAACAGTGTGACAGGCGGGG No data
1086701808_1086701815 -10 Left 1086701808 11:89907071-89907093 CCCCCTTGCATATAAGAAACAGT No data
Right 1086701815 11:89907084-89907106 AAGAAACAGTGTGACAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701815 Original CRISPR AAGAAACAGTGTGACAGGCG GGG Intergenic