ID: 1086701819

View in Genome Browser
Species Human (GRCh38)
Location 11:89907107-89907129
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086701811_1086701819 10 Left 1086701811 11:89907074-89907096 CCTTGCATATAAGAAACAGTGTG No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data
1086701808_1086701819 13 Left 1086701808 11:89907071-89907093 CCCCCTTGCATATAAGAAACAGT No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data
1086701807_1086701819 18 Left 1086701807 11:89907066-89907088 CCTCTCCCCCTTGCATATAAGAA No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data
1086701810_1086701819 11 Left 1086701810 11:89907073-89907095 CCCTTGCATATAAGAAACAGTGT No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data
1086701809_1086701819 12 Left 1086701809 11:89907072-89907094 CCCCTTGCATATAAGAAACAGTG No data
Right 1086701819 11:89907107-89907129 TGGACACACCCTGCGATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086701819 Original CRISPR TGGACACACCCTGCGATATG GGG Intergenic