ID: 1086704350

View in Genome Browser
Species Human (GRCh38)
Location 11:89937419-89937441
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086704350_1086704358 10 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704358 11:89937452-89937474 ACACTGTTTCTTATATGCAAGGG No data
1086704350_1086704361 17 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704350_1086704360 12 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704360 11:89937454-89937476 ACTGTTTCTTATATGCAAGGGGG No data
1086704350_1086704357 9 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704357 11:89937451-89937473 CACACTGTTTCTTATATGCAAGG No data
1086704350_1086704359 11 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704359 11:89937453-89937475 CACTGTTTCTTATATGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086704350 Original CRISPR GTGGACACACCCTGCGATAT GGG (reversed) Intergenic
No off target data available for this crispr