ID: 1086704353

View in Genome Browser
Species Human (GRCh38)
Location 11:89937441-89937463
Sequence AAGAAACAGTGTGACAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086704353_1086704360 -10 Left 1086704353 11:89937441-89937463 CCCCGCCTGTCACACTGTTTCTT No data
Right 1086704360 11:89937454-89937476 ACTGTTTCTTATATGCAAGGGGG No data
1086704353_1086704361 -5 Left 1086704353 11:89937441-89937463 CCCCGCCTGTCACACTGTTTCTT No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086704353 Original CRISPR AAGAAACAGTGTGACAGGCG GGG (reversed) Intergenic
No off target data available for this crispr