ID: 1086704359

View in Genome Browser
Species Human (GRCh38)
Location 11:89937453-89937475
Sequence CACTGTTTCTTATATGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086704349_1086704359 12 Left 1086704349 11:89937418-89937440 CCCCATATCGCAGGGTGTGTCCA No data
Right 1086704359 11:89937453-89937475 CACTGTTTCTTATATGCAAGGGG No data
1086704352_1086704359 -8 Left 1086704352 11:89937438-89937460 CCACCCCGCCTGTCACACTGTTT No data
Right 1086704359 11:89937453-89937475 CACTGTTTCTTATATGCAAGGGG No data
1086704351_1086704359 10 Left 1086704351 11:89937420-89937442 CCATATCGCAGGGTGTGTCCACC No data
Right 1086704359 11:89937453-89937475 CACTGTTTCTTATATGCAAGGGG No data
1086704350_1086704359 11 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704359 11:89937453-89937475 CACTGTTTCTTATATGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086704359 Original CRISPR CACTGTTTCTTATATGCAAG GGG Intergenic
No off target data available for this crispr