ID: 1086704361

View in Genome Browser
Species Human (GRCh38)
Location 11:89937459-89937481
Sequence TTCTTATATGCAAGGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086704355_1086704361 -7 Left 1086704355 11:89937443-89937465 CCGCCTGTCACACTGTTTCTTAT No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704353_1086704361 -5 Left 1086704353 11:89937441-89937463 CCCCGCCTGTCACACTGTTTCTT No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704352_1086704361 -2 Left 1086704352 11:89937438-89937460 CCACCCCGCCTGTCACACTGTTT No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704351_1086704361 16 Left 1086704351 11:89937420-89937442 CCATATCGCAGGGTGTGTCCACC No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704349_1086704361 18 Left 1086704349 11:89937418-89937440 CCCCATATCGCAGGGTGTGTCCA No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704350_1086704361 17 Left 1086704350 11:89937419-89937441 CCCATATCGCAGGGTGTGTCCAC No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704356_1086704361 -10 Left 1086704356 11:89937446-89937468 CCTGTCACACTGTTTCTTATATG No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data
1086704354_1086704361 -6 Left 1086704354 11:89937442-89937464 CCCGCCTGTCACACTGTTTCTTA No data
Right 1086704361 11:89937459-89937481 TTCTTATATGCAAGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086704361 Original CRISPR TTCTTATATGCAAGGGGGAG AGG Intergenic
No off target data available for this crispr