ID: 1086704933

View in Genome Browser
Species Human (GRCh38)
Location 11:89942434-89942456
Sequence CTGCAGTTCTGGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086704933_1086704942 22 Left 1086704933 11:89942434-89942456 CCCTGTGCCCTCCAGAACTGCAG No data
Right 1086704942 11:89942479-89942501 TCCTGCTTTCCAGGAGATTGTGG No data
1086704933_1086704941 13 Left 1086704933 11:89942434-89942456 CCCTGTGCCCTCCAGAACTGCAG No data
Right 1086704941 11:89942470-89942492 TGTGAGGCTTCCTGCTTTCCAGG No data
1086704933_1086704940 -3 Left 1086704933 11:89942434-89942456 CCCTGTGCCCTCCAGAACTGCAG No data
Right 1086704940 11:89942454-89942476 CAGCATGCTTGGGAATTGTGAGG No data
1086704933_1086704944 29 Left 1086704933 11:89942434-89942456 CCCTGTGCCCTCCAGAACTGCAG No data
Right 1086704944 11:89942486-89942508 TTCCAGGAGATTGTGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086704933 Original CRISPR CTGCAGTTCTGGAGGGCACA GGG (reversed) Intergenic
No off target data available for this crispr