ID: 1086711066

View in Genome Browser
Species Human (GRCh38)
Location 11:90009937-90009959
Sequence TAAGGGGATTGTGGAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086711066_1086711075 10 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711075 11:90009970-90009992 CCCAGAACTCCTTGGAAAGATGG No data
1086711066_1086711077 18 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711066_1086711079 19 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711079 11:90009979-90010001 CCTTGGAAAGATGGATTTGAGGG No data
1086711066_1086711072 2 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086711066 Original CRISPR TAAGGGGATTGTGGAAGGTG AGG (reversed) Intergenic
No off target data available for this crispr