ID: 1086711069

View in Genome Browser
Species Human (GRCh38)
Location 11:90009953-90009975
Sequence TCTGGGCTGGAATTTTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086711069_1086711077 2 Left 1086711069 11:90009953-90009975 CCCCTTAAAAATTCCAGCCCAGA No data
Right 1086711077 11:90009978-90010000 TCCTTGGAAAGATGGATTTGAGG No data
1086711069_1086711075 -6 Left 1086711069 11:90009953-90009975 CCCCTTAAAAATTCCAGCCCAGA No data
Right 1086711075 11:90009970-90009992 CCCAGAACTCCTTGGAAAGATGG No data
1086711069_1086711079 3 Left 1086711069 11:90009953-90009975 CCCCTTAAAAATTCCAGCCCAGA No data
Right 1086711079 11:90009979-90010001 CCTTGGAAAGATGGATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086711069 Original CRISPR TCTGGGCTGGAATTTTTAAG GGG (reversed) Intergenic
No off target data available for this crispr