ID: 1086711072

View in Genome Browser
Species Human (GRCh38)
Location 11:90009962-90009984
Sequence AATTCCAGCCCAGAACTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086711064_1086711072 4 Left 1086711064 11:90009935-90009957 CCCCTCACCTTCCACAATCCCCT No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711062_1086711072 26 Left 1086711062 11:90009913-90009935 CCAATCAAGCAGAATTTTCCAGC No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711068_1086711072 -7 Left 1086711068 11:90009946-90009968 CCACAATCCCCTTAAAAATTCCA No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711065_1086711072 3 Left 1086711065 11:90009936-90009958 CCCTCACCTTCCACAATCCCCTT No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711066_1086711072 2 Left 1086711066 11:90009937-90009959 CCTCACCTTCCACAATCCCCTTA No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711067_1086711072 -3 Left 1086711067 11:90009942-90009964 CCTTCCACAATCCCCTTAAAAAT No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data
1086711063_1086711072 8 Left 1086711063 11:90009931-90009953 CCAGCCCCTCACCTTCCACAATC No data
Right 1086711072 11:90009962-90009984 AATTCCAGCCCAGAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086711072 Original CRISPR AATTCCAGCCCAGAACTCCT TGG Intergenic
No off target data available for this crispr